miRBase entry: cel-mir-236

Stem-loop cel-mir-236


Accession
MI0000311
Description
Caenorhabditis elegans cel-mir-236 precursor miRNA mir-236
Gene
family?
RF04250; mir-236

Literature search
3 open access papers mention cel-mir-236
(8 sentences)

Sequence

232926 reads, 942.0 reads per million, 93 experiments
ucggugaccgauguccagCGUCUUACCUGUUCAAUAUUUAGAcugacuaucaaagagaucUAAUACUGUCAGGUAAUGACGCUggauugucaugucau
...(((((.((((((((((((((((((((..((.((((.(((((...........)).))))))).)).))))))).))))))))).))))..)))))

Structure
ucg     -c    -         -       UU  A    U   -  gacu 
   gugac  gaug uccagCGUC UUACCUG  CA UAUU AGA cu    a
   |||||  |||| ||||||||| |||||||  || |||| ||| ||    u
   uacug  cugu aggUCGCAG AAUGGAC  GU AUAA Ucu ga    c
---     ua    u         U       -U  C    -   a  gaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
This precursor sequence was predicted by comparative computational approaches [1,3]. The excised miRNA sequence was predicted to comprise bases 64 to 87, and the precise 5' and 3' ends were determined later [4]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
chrII: 7030180-7030277 [-]

Database links

Mature cel-miR-236-5p

Accession MIMAT0020332
Description Caenorhabditis elegans cel-miR-236-5p mature miRNA
Sequence 19 - CGUCUUACCUGUUCAAUAUUUAGA - 42
Evidence experimental
Illumina [7]
Database links

Mature cel-miR-236-3p

Accession MIMAT0000291
Description Caenorhabditis elegans cel-miR-236-3p mature miRNA
Sequence 61 - UAAUACUGUCAGGUAAUGACGCU - 83
Evidence experimental
cloned [1-2,4], Northern [1,3], PCR [3], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 12769849
    Computational and experimental identification of C. elegans microRNAs
    "Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J"
    "Mol Cell (2003) 11:1253-1263

  4. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  5. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  6. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577