MIR200B is a microRNA that plays a role in various biological processes, including diabetic retinopathy and epithelial to mesenchymal transition (EMT). In diabetic retinopathy, ANRIL regulates VEGF through interactions with PRC2 components p300, MIR200B, and enhancer of zeste homolog 2 (EZH2) [PMC8427604]. Bisulfite sequencing of the MIR200B promoter region has been performed [PMC4921922]. Epithelial signature genes such as CDH1, GRHL2, and the MIR200B cluster show higher levels of permissive marks (H3K4me3 and H3K27ac) and lower levels of the repressive mark H3K27me3 in cell lines with lower EMT score compared to cell lines with higher EMT score [PMC6656769]. In Hep-12 cells rich in tumor stem cells, MIR200B is downregulated along with other stem miRNAs [PMC7376200]. miPEP200a downregulates vimentin expression independently of miR200a and MIR200B activation [PMC8038077]. The MIR200 family, including MIR200a, MIR200B, MIR200c, MIR141, and MIR429 are targeted by several differentially methylated regions (DMRs) in UCS [PMC5237802]. Exposure to tobacco carcinogens leads to epigenetic silencing of MIR200B along with miR200c and miR205 during epithelial to mesenchymal transition (EMT) in lung epithelial cell cultures [PMC3763404].
cca uc ag g c - C ug gu gc gggc ccgu g CAUC UUACUGGGCAG AUUGGA ga c || |||| |||| | |||| ||||||||||| |||||| || cg cccg ggcg c GUAG AAUGGUCCGUC UAAUcu cu a gca -u -a g A U A -- gg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004571 |
Description | Homo sapiens hsa-miR-200b-5p mature miRNA |
Sequence | 21 - CAUCUUACUGGGCAGCAUUGGA - 42 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000318 |
Description | Homo sapiens hsa-miR-200b-3p mature miRNA |
Sequence | 57 - UAAUACUGCCUGGUAAUGAUGA - 78 |
Evidence |
experimental
Northern [1], cloned [2-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|