miRBase entry: hsa-mir-200b

Stem-loop hsa-mir-200b


Accession
MI0000342
Symbol
HGNC: MIR200B
Description
Homo sapiens hsa-mir-200b precursor miRNA mir-8
Gene
family?
RF00241; mir-8

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR200B is a microRNA implicated in various cellular processes, including the regulation of epithelial to mesenchymal transition (EMT) and the maintenance of epithelial characteristics [PMC6656769]. The epigenetic regulation of MIR200B is evident from bisulfite sequencing studies that have characterized its promoter region [PMC4921922]. The expression levels of MIR200B are inversely correlated with EMT scores in various cell lines; cell lines with lower EMT scores exhibit higher levels of MIR200B [PMC6656769]. However, the statement that MIR200B is regulated by ANRIL in the context of diabetic retinopathy is not supported by the provided context [PMC8427604]. Additionally, the claim that low expression levels of MIR200B in cancer stem cells from Hep-12 suggest a role in inhibiting stem cell-associated microRNAs is not substantiated by the context [PMC7376200]. miPEP200a can downregulate vimentin expression without activating miR200a and MIR200B, indicating a mechanism independent of these microRNAs [PMC8038077]. Differential methylation regions (DMRs) have been identified that target the MIR200 family including MIR200B in uterine carcinosarcoma (UCS), indicating that epigenetic modifications can affect its expression [PMC5237802]. Exposure to tobacco carcinogens has been shown to epigenetically silence MIR200B in lung epithelial cells and contribute to EMT phenotypic changes [PMC3763404].

Literature search
680 open access papers mention hsa-mir-200b
(4622 sentences)

Sequence

118810 reads, 1272 reads per million, 139 experiments
ccagcucgggcagccguggcCAUCUUACUGGGCAGCAUUGGAuggagucaggucucUAAUACUGCCUGGUAAUGAUGAcggcggagcccugcacg
...((..((((..((((.(.(((((((((((((((.((((((..((......)))))))).))))))))))).)))).).)))).)))).))...

Structure
cca  uc    ag    g c    -           C      ug  gu 
   gc  gggc  ccgu g CAUC UUACUGGGCAG AUUGGA  ga  c
   ||  ||||  |||| | |||| ||||||||||| ||||||  ||   
   cg  cccg  ggcg c GUAG AAUGGUCCGUC UAAUcu  cu  a
gca  -u    -a    g A    U           A      --  gg 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr1: 1167104-1167198 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-200b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-200b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-200b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-200b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-200b-5p

Accession MIMAT0004571
Description Homo sapiens hsa-miR-200b-5p mature miRNA
Sequence 21 - CAUCUUACUGGGCAGCAUUGGA - 42
Evidence experimental
cloned [4]
Database links
Predicted targets

Mature hsa-miR-200b-3p

Accession MIMAT0000318
Description Homo sapiens hsa-miR-200b-3p mature miRNA
Sequence 57 - UAAUACUGCCUGGUAAUGAUGA - 78
Evidence experimental
Northern [1], cloned [2-5]
Database links
Predicted targets

References

  1. PubMed ID: 12769849
    Computational and experimental identification of C. elegans microRNAs
    "Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J"
    "Mol Cell (2003) 11:1253-1263

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706