miRBase entry: hsa-let-7g

Stem-loop hsa-let-7g


Accession
MI0000433
Symbol
HGNC: MIRLET7G
Description
Homo sapiens hsa-let-7g precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7G is a microRNA that has been reported to have increased expression in canine and human mammary tumor cell lines [PMC9210832]. It is located at 3p21.1 and is one of the most common genes found in tumor samples [PMC5423597]. MIRLET7G has been identified as one of the top 40 differential genes in a study on pediatric cancers [PMC9730279]. It has also been found to interact with NANOG and POUSF1, suggesting its involvement in adipogenesis and osteogenesis differentiation processes [PMC4951121]. MIRLET7G, along with other microRNAs such as MIR302A, MIR21, and MR137, was selected for validation using qPCR [PMC4951121]. In addition to its role in cancer, MIRLET7G has also been implicated in retinal oxygenation and autophagy regulation [PMC8319207] [PMC6333457]. The reduced expression of MIRLET7G has been associated with the beneficial effects of retinal oxygenation in response to AFL treatment [PMC8319207]. Furthermore, E2 was found to suppress the expression of MIRLET7G in a time- and MAP2K/MEK-MAPK-dependent manner in MCF-7 cells [PMC6333457]. Overall, these findings highlight the importance of MIRLET7G as a potential biomarker and therapeutic target for various diseases.

Literature search
1077 open access papers mention hsa-let-7g
(6050 sentences)

Sequence

2546639 reads, 6904 reads per million, 153 experiments
aggcUGAGGUAGUAGUUUGUACAGUUugagggucuaugauaccacccgguacaggagauaaCUGUACAGGCCACUGCCUUGCca
.(((.((((((((.((((((((((((.....((((.((.((((....))))))..)))))))))))))))).))))))))))).

Structure
a   U        A            ugagg    -a  a    a 
 ggc GAGGUAGU GUUUGUACAGUU     gucu  ug uacc c
 ||| |||||||| ||||||||||||     ||||  || ||||  
 cCG UUCCGUCA CGGACAUGUCaa     uaga  ac augg c
a   -        C            -----    gg  -    c 


Annotation confidence High
Do you think this miRNA is real?
Comments
let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr3: 52268278-52268361 [-]

Disease association
hsa-let-7g is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7g-5p

Accession MIMAT0000414
Description Homo sapiens hsa-let-7g-5p mature miRNA
Sequence 5 - UGAGGUAGUAGUUUGUACAGUU - 26
Evidence experimental
cloned [2-3], Illumina [4]
Database links
Predicted targets

Mature hsa-let-7g-3p

Accession MIMAT0004584
Description Homo sapiens hsa-let-7g-3p mature miRNA
Sequence 62 - CUGUACAGGCCACUGCCUUGC - 82
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739