Stem-loop hsa-let-7g

Accession

MI0000433

Symbol

HGNC: MIRLET7G

Description

Homo sapiens hsa-let-7g precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIRLET7G is a microRNA that has been reported to have increased expression in canine and human mammary tumor cell lines [PMC9210832]. It is located at 3p21.1 and is one of the most common genes found in tumor samples [PMC5423597]. MIRLET7G has been identified as one of the top 40 differential genes in a study on pediatric cancers [PMC9730279]. It has also been found to interact with NANOG and POUSF1, suggesting its involvement in adipogenesis and osteogenesis differentiation processes [PMC4951121]. MIRLET7G, along with other microRNAs such as MIR302A, MIR21, and MR137, was selected for validation using qPCR [PMC4951121]. In addition to its role in cancer, MIRLET7G has also been implicated in retinal oxygenation and autophagy regulation [PMC8319207] [PMC6333457]. The reduced expression of MIRLET7G has been associated with the beneficial effects of retinal oxygenation in response to AFL treatment [PMC8319207]. Furthermore, E2 was found to suppress the expression of MIRLET7G in a time- and MAP2K/MEK-MAPK-dependent manner in MCF-7 cells [PMC6333457]. Overall, these findings highlight the importance of MIRLET7G as a potential biomarker and therapeutic target for various diseases.

Literature search

1077 open access papers mention hsa-let-7g
(6050 sentences)

Sequence

2546639 reads, 6904 reads per million, 153 experiments

aggcUGAGGUAGUAGUUUGUACAGUUugagggucuaugauaccacccgguacaggagauaaCUGUACAGGCCACUGCCUUGCca
.(((.((((((((.((((((((((((.....((((.((.((((....))))))..)))))))))))))))).))))))))))).

Structure

a   U        A            ugagg    -a  a    a 
 ggc GAGGUAGU GUUUGUACAGUU     gucu  ug uacc c
 ||| |||||||| ||||||||||||     ||||  || ||||  
 cCG UUCCGUCA CGGACAUGUCaa     uaga  ac augg c
a   -        C            -----    gg  -    c 

Annotation confidence High

Comments

let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context

chr3: 52268278-52268361 [-]

Disease association

hsa-let-7g is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-let-7g-5p

• Accession: MIMAT0000414
• Description: Homo sapiens hsa-let-7g-5p mature miRNA
• Sequence: 5 - UGAGGUAGUAGUUUGUACAGUU - 26
• Evidence: experimental ; cloned [2-3], Illumina [4]

Mature hsa-let-7g-3p

• Accession: MIMAT0004584
• Description: Homo sapiens hsa-let-7g-3p mature miRNA
• Sequence: 62 - CUGUACAGGCCACUGCCUUGC - 82
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739