WARNING: This summary was generated by AI. MIR125B1 is a microRNA gene that has been implicated in the pathophysiology of Alzheimer's disease (AD) due to its dysregulated expression in the brains of individuals with AD [PMC4861808]. This gene is of particular interest because it overlaps with one of the 10 CpG sites identified as having a significant association with AD, as highlighted in recent research [PMC4861808]. Furthermore, a specific CpG site, cg03891346, which is annotated to MIR125B1, has been found to correlate with the expression levels of another microRNA, miR-100-5p [PMC7056871]. This association suggests that MIR125B1 may play a role in the epigenetic regulation mechanisms that contribute to AD pathology [PMC7056871].
u uc u C C Au c gcgc cuc cagU CCUGAGA CCUAACUUGUG guuua c |||| ||| |||| ||||||| ||||||||||| ||||| g cgug gag gUCG GGGUUCU GGAUUGGGCAc uaaau u u cu c A C -c u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000423 |
| Description | Homo sapiens hsa-miR-125b-5p mature miRNA |
| Sequence | 15 - UCCCUGAGACCCUAACUUGUGA - 36 |
| Evidence |
experimental
cloned [2,4-6], Illumina [7] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004592 |
| Description | Homo sapiens hsa-miR-125b-1-3p mature miRNA |
| Sequence | 55 - ACGGGUUAGGCUCUUGGGAGCU - 76 |
| Evidence |
experimental
cloned [5] |
| Database links |
|
| Predicted targets |
|
|