miRBase entry: hsa-mir-125b-1

Stem-loop hsa-mir-125b-1


Accession
MI0000446
Symbol
HGNC: MIR125B1
Description
Homo sapiens hsa-mir-125b-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR125B1 is a microRNA gene that has been implicated in the pathophysiology of Alzheimer's disease (AD) due to its dysregulated expression in the brains of individuals with AD [PMC4861808]. This gene is of particular interest because it overlaps with one of the 10 CpG sites identified as having a significant association with AD, as highlighted in recent research [PMC4861808]. Furthermore, a specific CpG site, cg03891346, which is annotated to MIR125B1, has been found to correlate with the expression levels of another microRNA, miR-100-5p [PMC7056871]. This association suggests that MIR125B1 may play a role in the epigenetic regulation mechanisms that contribute to AD pathology [PMC7056871].

Literature search
685 open access papers mention hsa-mir-125b-1
(4187 sentences)

Sequence

802721 reads, 3611 reads per million, 157 experiments
ugcgcuccucucagUCCCUGAGACCCUAACUUGUGAuguuuaccguuuaaauccACGGGUUAGGCUCUUGGGAGCUgcgagucgugcu
.((((..(((.((((.(((((((.(((((((((((..(((((.....))))).))))))))))).))))))).)))).)))..)))).

Structure
u    uc   u    C       C           Au     c 
 gcgc  cuc cagU CCUGAGA CCUAACUUGUG  guuua c
 ||||  ||| |||| ||||||| |||||||||||  ||||| g
 cgug  gag gUCG GGGUUCU GGAUUGGGCAc  uaaau u
u    cu   c    A       C           -c     u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context
chr11: 122099757-122099844 [-]

Disease association
hsa-mir-125b-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-125b-5p

Accession MIMAT0000423
Description Homo sapiens hsa-miR-125b-5p mature miRNA
Sequence 15 - UCCCUGAGACCCUAACUUGUGA - 36
Evidence experimental
cloned [2,4-6], Illumina [7]
Database links
Predicted targets

Mature hsa-miR-125b-1-3p

Accession MIMAT0004592
Description Homo sapiens hsa-miR-125b-1-3p mature miRNA
Sequence 55 - ACGGGUUAGGCUCUUGGGAGCU - 76
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575

  7. PubMed ID: 15722555
    Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation
    "Lee YS, Kim HK, Chung S, Kim KS, Dutta A"
    "J Biol Chem (2005) 280:16635-16641