Stem-loop hsa-mir-125b-1

Accession

MI0000446

Symbol

HGNC: MIR125B1

Description

Homo sapiens hsa-mir-125b-1 precursor miRNA

Literature search

685 open access papers mention hsa-mir-125b-1
(4187 sentences)

Sequence

802721 reads, 3611 reads per million, 157 experiments

ugcgcuccucucagUCCCUGAGACCCUAACUUGUGAuguuuaccguuuaaauccACGGGUUAGGCUCUUGGGAGCUgcgagucgugcu
.((((..(((.((((.(((((((.(((((((((((..(((((.....))))).))))))))))).))))))).)))).)))..)))).

Structure

u    uc   u    C       C           Au     c 
 gcgc  cuc cagU CCUGAGA CCUAACUUGUG  guuua c
 ||||  ||| |||| ||||||| |||||||||||  ||||| g
 cgug  gag gUCG GGGUUCU GGAUUGGGCAc  uaaau u
u    cu   c    A       C           -c     u 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context

chr11: 122099757-122099844 [-]

Disease association

hsa-mir-125b-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-125b-5p

• Accession: MIMAT0000423
• Description: Homo sapiens hsa-miR-125b-5p mature miRNA
• Sequence: 15 - UCCCUGAGACCCUAACUUGUGA - 36
• Evidence: experimental ; cloned [2,4-6], Illumina [7]

Mature hsa-miR-125b-1-3p

• Accession: MIMAT0004592
• Description: Homo sapiens hsa-miR-125b-1-3p mature miRNA
• Sequence: 55 - ACGGGUUAGGCUCUUGGGAGCU - 76
• Evidence: experimental ; cloned [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


4. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854


5. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


6. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575


7. PubMed ID: 15722555
   Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation
   "Lee YS, Kim HK, Chung S, Kim KS, Dutta A"
   "J Biol Chem (2005) 280:16635-16641