miRBase entry: hsa-mir-141

Stem-loop hsa-mir-141


Accession
MI0000457
Symbol
HGNC: MIR141
Description
Homo sapiens hsa-mir-141 precursor miRNA mir-8
Gene
family?
RF00241; mir-8

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR141, a tumor suppressor microRNA, has been implicated in the regulation of tumor growth and immune escape in stomach cancer cells [PMC4673276]'>PMC4673276], [PMC7468375]. Studies have demonstrated that the overexpression of MIR141, achieved by infecting cells with a virus containing pLenti 4.1 MIR141, can comparably inhibit tumor growth to the knockdown of KLF8 [PMC4673276]. This microRNA exerts its suppressive effects by targeting ZEB1, a potent inducer of epithelial-mesenchymal transition (EMT) [PMC4673276]. Furthermore, the expression levels of mature hsa-miR-141-3p are significantly reduced upon targeted inhibition of MIR141 [PMC8021117]. Abnormal expression patterns of miR-141 have been observed in preeclampsia (PE) placentas and can influence immune cells through extracellular vesicles (EVs) [PMC9104507]. Additionally, the genomic locus U47924.27 that includes MIR200C and MIR141 has been identified as hypo-methylated and over-expressed in gastric cancer (GC), suggesting an epigenetic mechanism for its dysregulation [PMC5041931]. The mir-200 family genes including MIR141 are also noted for their roles in olfactory system development and gonadotropin-releasing hormone (GnRH) neuron development, making them subjects for screening in Kallmann syndrome patients [PMC6479198].

Literature search
981 open access papers mention hsa-mir-141
(3973 sentences)

Sequence

58087 reads, 219.0 reads per million, 181 experiments
cggccggcccugggucCAUCUUCCAGUACAGUGUUGGAuggucuaauugugaagcuccUAACACUGUCUGGUAAAGAUGGcucccggguggguuc
.((((.((((.(((.(((((((((((.(((((((((((...((.......))...))).))))))))))))..)))))))..))))))).)))).

Structure
c    g    u   -u       --    U        -   ugg  ua 
 ggcc gccc ggg  cCAUCUU  CCAG ACAGUGUU GGA   uc  a
 |||| |||| |||  |||||||  |||| |||||||| |||   ||  u
 uugg uggg ccc  GGUAGAA  GGUC UGUCACAA ccu   ag  u
c    g    -   uc       AU    -        U   cga  ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2].

Genome context
chr12: 6964097-6964191 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-141
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-141 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-141-5p

Accession MIMAT0004598
Description Homo sapiens hsa-miR-141-5p mature miRNA
Sequence 17 - CAUCUUCCAGUACAGUGUUGGA - 38
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-141-3p

Accession MIMAT0000432
Description Homo sapiens hsa-miR-141-3p mature miRNA
Sequence 59 - UAACACUGUCUGGUAAAGAUGG - 80
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739