MIR141, a tumor suppressor microRNA, has been implicated in the regulation of tumor growth and immune escape in stomach cancer cells [PMC4673276]'>PMC4673276], [PMC7468375]. Studies have demonstrated that the overexpression of MIR141, achieved by infecting cells with a virus containing pLenti 4.1 MIR141, can comparably inhibit tumor growth to the knockdown of KLF8 [PMC4673276]. This microRNA exerts its suppressive effects by targeting ZEB1, a potent inducer of epithelial-mesenchymal transition (EMT) [PMC4673276]. Furthermore, the expression levels of mature hsa-miR-141-3p are significantly reduced upon targeted inhibition of MIR141 [PMC8021117]. Abnormal expression patterns of miR-141 have been observed in preeclampsia (PE) placentas and can influence immune cells through extracellular vesicles (EVs) [PMC9104507]. Additionally, the genomic locus U47924.27 that includes MIR200C and MIR141 has been identified as hypo-methylated and over-expressed in gastric cancer (GC), suggesting an epigenetic mechanism for its dysregulation [PMC5041931]. The mir-200 family genes including MIR141 are also noted for their roles in olfactory system development and gonadotropin-releasing hormone (GnRH) neuron development, making them subjects for screening in Kallmann syndrome patients [PMC6479198].
c g u -u -- U - ugg ua ggcc gccc ggg cCAUCUU CCAG ACAGUGUU GGA uc a |||| |||| ||| ||||||| |||| |||||||| ||| || u uugg uggg ccc GGUAGAA GGUC UGUCACAA ccu ag u c g - uc AU - U cga ug
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004598 |
Description | Homo sapiens hsa-miR-141-5p mature miRNA |
Sequence | 17 - CAUCUUCCAGUACAGUGUUGGA - 38 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000432 |
Description | Homo sapiens hsa-miR-141-3p mature miRNA |
Sequence | 59 - UAACACUGUCUGGUAAAGAUGG - 80 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|