MIR141 is a microRNA that functions as a tumor suppressor by repressing ZEB1, an inducer of epithelial-mesenchymal transition (EMT) [PMC4673276]. Two cell lines, 10A-iK8 and 231-K8ikd, were infected with viruses derived from pLenti 4.1 MIR141 and selected with puromycin to generate 10A-iK8-MIR141 and 231-K8ikd-MIR141 cell lines [PMC4673276]. The overexpression of MIR141 inhibited tumor growth in a manner comparable to the knockdown of KLF8 (U + MIR141) [PMC4673276]. MIR141 was found to directly regulate PD-L1, which is involved in the immune escape of stomach cancer cells [PMC7468375]. The expression of mature hsa-miR-141-3p was significantly reduced upon targeting MIR141 compared to the control [PMC8021117]. Abnormal expression of MIR141 was observed in placental tissues from preeclampsia (PE) patients, and elevated levels of MIR141 were transferred from trophoblasts to immune cells through extracellular vesicles (EVs) [PMC9104507]. The U47924.27 locus containing MIR200C and MIR141 was found to be hypo-methylated at its promoter and overexpressed in gastric cancer [PMC5041931]. In a study on Kallmann syndrome patients, genes from the mir-200 family including MIR141 were screened due to their known role in olfactory system development and GnRH neuron development [PMC6479198]. References: [PMC4673276]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4673276/ [PMC7468375]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7468375/ [PMC8021117]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8021117/ [PMC9104507]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9104507/ [PMC5041931]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5041931/ [PMC6479198]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6479198/
c g u -u -- U - ugg ua ggcc gccc ggg cCAUCUU CCAG ACAGUGUU GGA uc a |||| |||| ||| ||||||| |||| |||||||| ||| || u uugg uggg ccc GGUAGAA GGUC UGUCACAA ccu ag u c g - uc AU - U cga ug
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004598 |
Description | Homo sapiens hsa-miR-141-5p mature miRNA |
Sequence | 17 - CAUCUUCCAGUACAGUGUUGGA - 38 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0000432 |
Description | Homo sapiens hsa-miR-141-3p mature miRNA |
Sequence | 59 - UAACACUGUCUGGUAAAGAUGG - 80 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
|