WARNING: This summary was generated by AI. MIR152 is a microRNA whose expression levels were observed to return to control levels in cells exposed to lipopolysaccharide (LPS) when treated with MK1903, as opposed to cells treated with LPS alone or the vehicle (veh) group [PMC9994484]. This suggests that MK1903 may have a regulatory effect on MIR152 expression in the context of LPS exposure. Additionally, MIR152 is implicated in liver epithelial-to-mesenchymal transition (EMT) as it can be competitively bound by the long non-coding RNA plasmacytoma variant translocation 1 (PVT1), which indicates a potential role for MIR152 in liver EMT processes [PMC8990740].
u cc c G A CC cgg c gucc cc ggcccAGGUUCUGU AU CACU GACU gcu u |||| || |||||||||||||| || |||| |||| ||| cagg gg ccgGGUUCAAGACA UA GUGA CUga cga g c aa c G C -- --- g
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000438 |
| Description | Homo sapiens hsa-miR-152-3p mature miRNA |
| Sequence | 54 - UCAGUGCAUGACAGAACUUGG - 74 |
| Evidence |
experimental
cloned [2-3], Illumina [4-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026479 |
| Description | Homo sapiens hsa-miR-152-5p mature miRNA |
| Sequence | 16 - AGGUUCUGUGAUACACUCCGACU - 38 |
| Evidence |
experimental
Illumina [5] |
|