miRBase entry: hsa-mir-152

Stem-loop hsa-mir-152


Accession
MI0000462
Symbol
HGNC: MIR152
Description
Homo sapiens hsa-mir-152 precursor miRNA
Gene family
MIPF0000056; mir-148

Literature search
146 open access papers mention hsa-mir-152
(888 sentences)

Sequence

277009 reads, 813 reads per million, 150 experiments
ugucccccccggcccAGGUUCUGUGAUACACUCCGACUcgggcucuggagcagUCAGUGCAUGACAGAACUUGGgcccggaaggacc
.((((..((.((((((((((((((.((.((((..((((...(((....))))))))))).)).)))))))))))))).))..)))).

Structure
u    cc  c              G  A    CC    cgg   c 
 gucc  cc ggcccAGGUUCUGU AU CACU  GACU   gcu u
 ||||  || |||||||||||||| || ||||  ||||   |||  
 cagg  gg ccgGGUUCAAGACA UA GUGA  CUga   cga g
c    aa  c              G  C    --    ---   g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr17: 48037161-48037247 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-152
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-152 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-152-3p

Accession MIMAT0000438
Description Homo sapiens hsa-miR-152-3p mature miRNA
Sequence 54 - UCAGUGCAUGACAGAACUUGG - 74
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature hsa-miR-152-5p

Accession MIMAT0026479
Description Homo sapiens hsa-miR-152-5p mature miRNA
Sequence 16 - AGGUUCUGUGAUACACUCCGACU - 38
Evidence experimental
Illumina [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45