MIR152 is a microRNA that has been found to play a role in various cellular processes [PMC9994484]. In a study, it was observed that in cells exposed to lipopolysaccharide (LPS) in the presence of MK1903, the expression of miR‐128, miR‐425, and miR‐130 was significantly increased compared to both the LPS and vehicle groups [PMC9994484]. On the other hand, the expression of miR‐19, MIR152, miR‐301, and miR‐29 was rescued to control levels [PMC9994484]. Additionally, it has been discovered that lncRNA plasmacytoma variant translocation 1 (PVT1) triggers liver epithelial-mesenchymal transition (EMT) by competitively binding to MIR152 [PMC8990740]. These findings suggest that MIR152 may have a regulatory role in cellular responses to LPS exposure and liver EMT [PMC9994484][PMC8990740[PMC8990740]. Further research is needed to fully understand the mechanisms by which MIR152 functions and its potential implications in various biological processes [PMC9994484][PMC8990740[PMC8990740].
u cc c G A CC cgg c gucc cc ggcccAGGUUCUGU AU CACU GACU gcu u |||| || |||||||||||||| || |||| |||| ||| cagg gg ccgGGUUCAAGACA UA GUGA CUga cga g c aa c G C -- --- g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000438 |
Description | Homo sapiens hsa-miR-152-3p mature miRNA |
Sequence | 54 - UCAGUGCAUGACAGAACUUGG - 74 |
Evidence |
experimental
cloned [2-3], Illumina [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026479 |
Description | Homo sapiens hsa-miR-152-5p mature miRNA |
Sequence | 16 - AGGUUCUGUGAUACACUCCGACU - 38 |
Evidence |
experimental
Illumina [5] |
|