MIR9-2 is a gene belonging to the mir-9 family, which is involved in neurogenesis [PMC6723948]. In a study investigating the methylation status of mir9-1, MIR9-2, and MIR9-3 promoters in tumors and normal margins, the researchers explored the possible correlation with clinopathological features [PMC5019297]. One of the polymorphisms investigated was rs4916723, located downstream of the MIR9-2 gene and previously associated with ADHD [PMC6723948]. The MIR9-2 gene is encoded on the same strand as three splice forms of LINC00461 and knockdown of LINC00461 significantly reduced mir-9 expression levels, suggesting a relationship between these genes and providing a potential link between rs4916723 and MIR9-2 [PMC6723948]. MiR-9-5p is the major transcript from genes MIR9-1, MIR9-2, and MIR9-3 located on chromosomes 1, 5, and 15 [PMC6162741]. The regulation of MIR9-2 was found to involve a relevant motif in a specific region on chromosome 5 [PMC5366901]. Additionally, Tbr2 and Tbr1 were found to directly repress MIR9-2 (encoding miR-*), as shown in studies on non-coding RNA (ncRNA) [PMC6113890].
g c g C G u ua gaag gaguu uuaU UUUGGUUAUCUAGCU UAUGAg g u |||| ||||| |||| ||||||||||||||| |||||| | u cuuc cucaa aaUG AAGCCAAUAGAUCGA AUAcuu c g a - a A A - ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000441 |
Description | Homo sapiens hsa-miR-9-5p mature miRNA |
Sequence | 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000442 |
Description | Homo sapiens hsa-miR-9-3p mature miRNA |
Sequence | 53 - AUAAAGCUAGAUAACCGAAAGU - 74 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|