WARNING: This summary was generated by AI. MIR125A, a microRNA, has been evaluated for its potential as a diagnostic biomarker for differentiating between papillary thyroid carcinoma (PTC) and benign thyroid nodules through ROC curve analysis [PMC9221779]. This analysis revealed that MIR125A, along with other microRNAs, shows significant differences between the two groups [PMC9221779]. Specifically, MIR125A is involved in the regulation of granulocytic differentiation by targeting Clec5a/MDL1 expression [PMC4335136]. The inhibition of granulocytic differentiation by ASXL1-MT in 32D cells can be counteracted by the expression of Clec5a, indicating the functional importance of MIR125A in this cellular process [PMC4335136].
u u u C C UA ---- a gccag c cuaggU CCUGAGA CCUU ACCUGUGA gg c ||||| | |||||| ||||||| |||| |||||||| || cgguc g gguCCG GGGUUCU GGAG UGGACAcu cc a c u c A U -- ggga u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000443 |
| Description | Homo sapiens hsa-miR-125a-5p mature miRNA |
| Sequence | 15 - UCCCUGAGACCCUUUAACCUGUGA - 38 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004602 |
| Description | Homo sapiens hsa-miR-125a-3p mature miRNA |
| Sequence | 53 - ACAGGUGAGGUUCUUGGGAGCC - 74 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|