miRBase entry: hsa-mir-125a

Stem-loop hsa-mir-125a


Accession
MI0000469
Symbol
HGNC: MIR125A
Description
Homo sapiens hsa-mir-125a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR125A, a microRNA, has been evaluated for its potential as a diagnostic biomarker for differentiating between papillary thyroid carcinoma (PTC) and benign thyroid nodules through ROC curve analysis [PMC9221779]. This analysis revealed that MIR125A, along with other microRNAs, shows significant differences between the two groups [PMC9221779]. Specifically, MIR125A is involved in the regulation of granulocytic differentiation by targeting Clec5a/MDL1 expression [PMC4335136]. The inhibition of granulocytic differentiation by ASXL1-MT in 32D cells can be counteracted by the expression of Clec5a, indicating the functional importance of MIR125A in this cellular process [PMC4335136].

Literature search
389 open access papers mention hsa-mir-125a
(1745 sentences)

Sequence

408667 reads, 3166 reads per million, 138 experiments
ugccagucucuaggUCCCUGAGACCCUUUAACCUGUGAggacauccagggucACAGGUGAGGUUCUUGGGAGCCuggcgucuggcc
.(((((.(.((((((.(((((((.((((..((((((((((....))....)))))))))))).))))))).)))))).).))))).

Structure
u     u u      C       C    UA        ----  a 
 gccag c cuaggU CCUGAGA CCUU  ACCUGUGA    gg c
 ||||| | |||||| ||||||| ||||  ||||||||    ||  
 cgguc g gguCCG GGGUUCU GGAG  UGGACAcu    cc a
c     u c      A       U    --        ggga  u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr19: 51693254-51693339 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-125a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-125a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-125a-5p

Accession MIMAT0000443
Description Homo sapiens hsa-miR-125a-5p mature miRNA
Sequence 15 - UCCCUGAGACCCUUUAACCUGUGA - 38
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-125a-3p

Accession MIMAT0004602
Description Homo sapiens hsa-miR-125a-3p mature miRNA
Sequence 53 - ACAGGUGAGGUUCUUGGGAGCC - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739