miRBase entry: mmu-mir-24-2

Stem-loop mmu-mir-24-2


Accession
MI0000572
Symbol
MGI: Mir24-2
Description
Mus musculus mmu-mir-24-2 precursor miRNA mir-24
Gene
family?
RF00178; mir-24

Literature search
142 open access papers mention mmu-mir-24-2
(1248 sentences)

Sequence

1563330 reads, 10986 reads per million, 107 experiments
gccucucuccgggcuccgccucccGUGCCUACUGAGCUGAAACAGUugauuccagugcacUGGCUCAGUUCAGCAGGAACAGgaguccagcccccuaggagcuggca
(((...(((((((((....((((.((.(((.(((((((((..((((..((....))..))))..))))))))).))).)).))))...)))))....))))..))).

Structure
-   ucu    ----     ccgc    c  G   A         AA    ug  u 
 gcc   cucc    gggcu    cucc GU CCU CUGAGCUGA  CAGU  au c
 |||   ||||    |||||    |||| || ||| |||||||||  ||||  ||  
 cgg   gagg    cccga    gagG CA GGA GACUUGACU  GUca  ug c
a   -uc    aucc     -ccu    A  A   C         CG    cg  a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr8: 84208815-84208921 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from mmu-mir-24-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-24-3p

Accession MIMAT0000219
Description Mus musculus mmu-miR-24-3p mature miRNA
Sequence 61 - UGGCUCAGUUCAGCAGGAACAG - 82
Evidence experimental
cloned [1-2,4-6], Northern [2], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-24-2-5p

Accession MIMAT0005440
Description Mus musculus mmu-miR-24-2-5p mature miRNA
Sequence 25 - GUGCCUACUGAGCUGAAACAGU - 46
Evidence experimental
cloned [6], Illumina [7-8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  6. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  7. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  8. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009