Stem-loop mmu-mir-210

Accession

MI0000695

Symbol

MGI: Mir210

Description

Mus musculus mmu-mir-210 precursor miRNA

Literature search

121 open access papers mention mmu-mir-210
(1268 sentences)

Sequence

81116 reads, 436 reads per million, 106 experiments

ccggggcagucccuccaggcucaggacAGCCACUGCCCACCGCACACUGcguugcuccggacccaCUGUGCGUGUGACAGCGGCUGAucugucccugggcagcgcgaacc
..(((.....)))((((((..((((.(((((.(((..(((((((((.((.(((......))).)).)))))).))).))).))))).))))..))))))...........

Structure

ccggggcaguccc      cu    a     A   CC   -      C  c   gc 
             uccagg  cagg cAGCC CUG  CAC CGCACA UG guu  u
             ||||||  |||| ||||| |||  ||| |||||| || |||   
             gggucc  gucu GUCGG GAC  GUG GCGUGU ac cag  c
--ccaagcgcgac      cu    A     C   -A   U      C  c   gc 

Annotation confidence High

Comments

Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MIR:MI0000286) [1]. Its expression in mouse was later verified independently [2,4].

Genome context

chr7: 141221384-141221493 [-]

Mature mmu-miR-210-5p

• Accession: MIMAT0017052
• Description: Mus musculus mmu-miR-210-5p mature miRNA
• Sequence: 28 - AGCCACUGCCCACCGCACACUG - 49
• Evidence: experimental ; 454 [6], Illumina [7]

Mature mmu-miR-210-3p

• Accession: MIMAT0000658
• Description: Mus musculus mmu-miR-210-3p mature miRNA
• Sequence: 66 - CUGUGCGUGUGACAGCGGCUGA - 87
• Evidence: experimental ; cloned [2,4], Illumina [5,7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


7. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275