miRBase entry: mmu-mir-219a-1

Stem-loop mmu-mir-219a-1


Accession
MI0000702
Symbol
MGI: Mir219a-1
Description
Mus musculus mmu-mir-219a-1 precursor miRNA
Gene family
MIPF0000044; mir-219

Literature search
47 open access papers mention mmu-mir-219a-1
(479 sentences)

Sequence

30671 reads, 359 reads per million, 100 experiments
ccgucccgggccgcggcuccUGAUUGUCCAAACGCAAUUCUcgagucucuggcuccggccgAGAGUUGCGUCUGGACGUCCCGagccgccgcccccaaaccucgaggggg
...((((((((.(((((((..(((.(((((.((((((((((((.(((.........))))))))))))))).))))))))..))))))).))))...........)))).

Structure
ccg    -----------    c       cU   U     A            a   ucu 
   uccc           gggc gcggcuc  GAU GUCCA ACGCAAUUCUcg guc   g
   ||||           |||| |||||||  ||| ||||| |||||||||||| |||   g
   gggg           cccg cgccgaG  CUG CAGGU UGCGUUGAGAgc cgg   c
--g    agcuccaaacc    c       CC   -     C            -   ccu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 34024983-34025092 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-219a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-219a-5p

Accession MIMAT0000664
Description Mus musculus mmu-miR-219a-5p mature miRNA
Sequence 21 - UGAUUGUCCAAACGCAAUUCU - 41
Evidence experimental
Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-219a-1-3p

Accession MIMAT0017055
Description Mus musculus mmu-miR-219a-1-3p mature miRNA
Sequence 62 - AGAGUUGCGUCUGGACGUCCCG - 83
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73