miRBase entry: mmu-mir-92a-1

Stem-loop mmu-mir-92a-1


Accession
MI0000719
Description
Mus musculus mmu-mir-92a-1 precursor miRNA

Literature search
139 open access papers mention mmu-mir-92a-1
(894 sentences)

Sequence

4474260 reads, 10491 reads per million, 107 experiments
cuuucuacacAGGUUGGGAUUUGUCGCAAUGCUguguuucucuguauggUAUUGCACUUGUCCCGGCCUGuugaguuugg
....((..((((((((((((..((.(((((((((((........)))))))))))))..))))))))))))..)).....

Structure
-cuuu  ac            UU  C           uuu 
     cu  acAGGUUGGGAU  GU GCAAUGCUgug   c
     ||  ||||||||||||  || |||||||||||    
     ga  uGUCCGGCCCUG  CA CGUUAUgguau   u
gguuu  gu            UU  -           guc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The predominant miR-92 form cloned by Landgraf et al. has a additional 3' U residue, which is compatible with this precursor sequence, but not with that of mir-92-2 (MIR:MI0000580) [4].

Genome context
chr14: 115044427-115044506 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-92a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-92a-3p

Accession MIMAT0000539
Description Mus musculus mmu-miR-92a-3p mature miRNA
Sequence 50 - UAUUGCACUUGUCCCGGCCUG - 70
Evidence experimental
cloned [1,3-4], Northern [1], Illumina [5,7]
Database links
Predicted targets

Mature mmu-miR-92a-1-5p

Accession MIMAT0017066
Description Mus musculus mmu-miR-92a-1-5p mature miRNA
Sequence 11 - AGGUUGGGAUUUGUCGCAAUGCU - 33
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275