Stem-loop mmu-mir-217

Accession

MI0000731

Symbol

MGI: Mir217

Description

Mus musculus mmu-mir-217 precursor miRNA mir-217

Gene
family

RF00673; mir-217

Literature search

34 open access papers mention mmu-mir-217
(230 sentences)

Sequence

52169 reads, 270 reads per million, 53 experiments

aaacauagucauuacaguuuuugauguugcagaUACUGCAUCAGGAACUGACUGGAuaagacuuaaucccCAUCAGUUCCUAAUGCAUUGCCUucagcaucuaaacaa
................((((..(((((((.((.((.(((((.(((((((((..((((........))))...))))))))).))))).)).)).))))))).))))..

Structure

aaacauagucauuaca    uu       c  a  C     C         -CU    aag 
                guuu  gauguug ag UA UGCAU AGGAACUGA   GGAu   a
                ||||  ||||||| || || ||||| |||||||||   ||||    
                caaa  cuacgac UC GU ACGUA UCCUUGACU   ccua   c
--------------aa    -u       u  C  U     A         ACc    auu 

Annotation confidence Medium

Comments

This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MIR:MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3].

Genome context

chr11: 28763728-28763835 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-217

Mature mmu-miR-217-5p

• Accession: MIMAT0000679
• Description: Mus musculus mmu-miR-217-5p mature miRNA
• Sequence: 34 - UACUGCAUCAGGAACUGACUGGA - 56
• Evidence: experimental ; cloned [3], Illumina [4,6]

Mature mmu-miR-217-3p

• Accession: MIMAT0017072
• Description: Mus musculus mmu-miR-217-3p mature miRNA
• Sequence: 71 - CAUCAGUUCCUAAUGCAUUGCCU - 93
• Evidence: experimental ; 454 [5], Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275