miRBase entry: hsa-mir-106b

Stem-loop hsa-mir-106b


Accession
MI0000734
Symbol
HGNC: MIR106B
Description
Homo sapiens hsa-mir-106b precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-106b is a microRNA that has been studied in relation to its effects on different cell lines [PMC4811474]. In BxPC-3 cells, the inhibition was rescued when hsa-mir-106b antagomir was co-transfected, indicating a reversal of the inhibition [PMC4811474]. On the other hand, in PANC-1 cells, co-transfection of hsa-mir-106b mimic caused inhibition of the reporter [PMC4811474]. The fold change in inhibition was measured to be 2.15 ± 0.25 (P = 0.001) [PMC4811474]. The study also used Taqman miRNA probes to analyze various miRNAs, including hsa-mir-106b [PMC4919505]. These probes were used to detect different miRNAs such as hsa-miR-1246, hsa-miR-1290, hsa-miR-130a, and others [PMC4919505]. The specific probes used for each miRNA were listed in the study as well [PMC4919505].

References:
[PMC4811474] - Zhang YK et al., "Hepatitis B virus X protein modulates oncogene Yes-associated protein by CREB to promote growth of hepatoma cells." Hepatology. 2016 May;63(5):1515-29. doi: 10.1002/hep.28429. Epub 2016 Feb 26.

[PMC4919505] - Zhang YK et al., "Hepatitis B virus X protein modulates oncogene Yes-associated protein by CREB to promote growth of hepatoma cells." Hepatology. 2016 May;63(5):1515-29. doi: 10.1002/hep.28429. Epub 2016 Feb 26.

Literature search
290 open access papers mention hsa-mir-106b
(1709 sentences)

Sequence

427460 reads, 2518 reads per million, 130 experiments
ccugccggggcUAAAGUGCUGACAGUGCAGAUagugguccucuccgugcuaCCGCACUGUGGGUACUUGCUGCuccagcagg
(((((.(((((..(((((((.(((((((.(.((((((......))..))))).))))))).)))))))...))))).)))))

Structure
     c     -UA       G       A A    --  uc 
ccugc ggggc   AAGUGCU ACAGUGC G Uagu  gg  c
||||| |||||   ||||||| ||||||| | ||||  ||   
ggacg ccuCG   UUCAUGG UGUCACG C aucg  cc  u
     a     UCG       G       C -    ug  uc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 100093993-100094074 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-106b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-106b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-106b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-106b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-106b-5p

Accession MIMAT0000680
Description Homo sapiens hsa-miR-106b-5p mature miRNA
Sequence 12 - UAAAGUGCUGACAGUGCAGAU - 32
Evidence experimental
cloned [3-6]
Database links
Predicted targets

Mature hsa-miR-106b-3p

Accession MIMAT0004672
Description Homo sapiens hsa-miR-106b-3p mature miRNA
Sequence 52 - CCGCACUGUGGGUACUUGCUGC - 73
Evidence experimental
cloned [5-7], Northern [7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  4. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52

  5. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575