Hsa-mir-106b is a microRNA involved in the regulation of gene expression in various cellular processes [PMC4919505]. In BxPC-3 cells, the inhibition of gene expression was reversed upon the introduction of a hsa-mir-106b antagomir, indicating that hsa-mir-106b plays a role in suppressing gene expression [PMC4811474]. Conversely, when hsa-mir-106b mimic was co-transfected into PANC-1 cells, there was a significant inhibition of the reporter gene by more than two-fold [PMC4811474]. This suggests that hsa-mir-106b can function as an oncomiR or tumor suppressor depending on the cellular context. The use of Taqman miRNA probes for hsa-mir-106b (000442) among others facilitates the study and quantification of microRNAs and their role in cellular functions [PMC4919505].
c -UA G A A -- uc ccugc ggggc AAGUGCU ACAGUGC G Uagu gg c ||||| ||||| ||||||| ||||||| | |||| || ggacg ccuCG UUCAUGG UGUCACG C aucg cc u a UCG G C - ug uc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000680 |
Description | Homo sapiens hsa-miR-106b-5p mature miRNA |
Sequence | 12 - UAAAGUGCUGACAGUGCAGAU - 32 |
Evidence |
experimental
cloned [3-6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004672 |
Description | Homo sapiens hsa-miR-106b-3p mature miRNA |
Sequence | 52 - CCGCACUGUGGGUACUUGCUGC - 73 |
Evidence |
experimental
cloned [5-7], Northern [7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|