Stem-loop hsa-mir-200a

Accession

MI0000737

Symbol

HGNC: MIR200A

Description

Homo sapiens hsa-mir-200a precursor miRNA mir-8

Gene
family

RF00241; mir-8

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR200A is a regulatory gene that is involved in epithelial cell function [PMC7948487]. In a study conducted on A549 cells, the state of H3K36 methylation was examined on the regulatory regions of various epithelial genes, including CDH1, MIR200A, CGN, and the unrelated GAPDH gene [PMC7948487]. In another study involving mesangial cells treated with high glucose and kidneys in diabetic mice models, it was observed that MIR200A was downregulated [PMC5590408]. This downregulation of MIR200A was accompanied by an upregulation of miR-377 and a downregulation of miR-141 [PMC5590408]. These findings suggest that MIR200A may play a role in the regulation of gene expression in epithelial cells and may be involved in diabetic kidney disease [PMC5590408]. Further research is needed to fully understand the mechanisms by which MIR200A influences gene expression and its potential implications for disease pathology.

Literature search

692 open access papers mention hsa-mir-200a
(4085 sentences)

Sequence

319655 reads, 1523 reads per million, 144 experiments

ccgggccccugugagCAUCUUACCGGACAGUGCUGGAuuucccagcuugacucUAACACUGUCUGGUAACGAUGUucaaaggugacccgc
.(((((.(((.(((((((((((((((((((((((((.....)))))...........)))))))))))).)))))))).))).).)))).

Structure

c    - c   g        -            -----------     A 
 cggg c ccu ugagCAUC UUACCGGACAGU           GCUGG u
 |||| | ||| |||||||| ||||||||||||           ||||| u
 gccc g gga acuUGUAG AAUGGUCUGUCA           cgacc u
c    a u   a        C            CAAUcucaguu     c 

Annotation confidence High

Comments

miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3].

Genome context

chr1: 1167863-1167952 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-200a

Disease association

hsa-mir-200a is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-200a-5p

• Accession: MIMAT0001620
• Description: Homo sapiens hsa-miR-200a-5p mature miRNA
• Sequence: 16 - CAUCUUACCGGACAGUGCUGGA - 37
• Evidence: experimental ; cloned [3-4]

Mature hsa-miR-200a-3p

• Accession: MIMAT0000682
• Description: Homo sapiens hsa-miR-200a-3p mature miRNA
• Sequence: 54 - UAACACUGUCUGGUAACGAUGU - 75
• Evidence: experimental ; cloned [3-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


4. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


5. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706