miRBase entry: hsa-mir-200a

Stem-loop hsa-mir-200a


Accession
MI0000737
Symbol
HGNC: MIR200A
Description
Homo sapiens hsa-mir-200a precursor miRNA mir-8
Gene
family?
RF00241; mir-8

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR200A is a microRNA involved in the regulation of epithelial gene expression, and its methylation status has been studied in the context of A549 cells, a type of lung carcinoma cell line [PMC7948487]. Specifically, research has indicated that the regulatory regions of MIR200A undergo changes in H3K36 methylation, which is a marker associated with active transcription and can influence gene expression [PMC7948487]. In pathological conditions such as diabetes, MIR200A expression has been observed to decrease both in mesangial cells exposed to high glucose and in kidney tissues from diabetic mouse models [PMC5590408]. This downregulation of MIR200A is noteworthy as it occurs alongside the upregulation of miR-377 and downregulation of miR-141, suggesting a coordinated alteration in microRNA expression that could contribute to diabetic complications [PMC5590408].

Literature search
692 open access papers mention hsa-mir-200a
(4085 sentences)

Sequence

319655 reads, 1523 reads per million, 144 experiments
ccgggccccugugagCAUCUUACCGGACAGUGCUGGAuuucccagcuugacucUAACACUGUCUGGUAACGAUGUucaaaggugacccgc
.(((((.(((.(((((((((((((((((((((((((.....)))))...........)))))))))))).)))))))).))).).)))).

Structure
c    - c   g        -            -----------     A 
 cggg c ccu ugagCAUC UUACCGGACAGU           GCUGG u
 |||| | ||| |||||||| ||||||||||||           ||||| u
 gccc g gga acuUGUAG AAUGGUCUGUCA           cgacc u
c    a u   a        C            CAAUcucaguu     c 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3].

Genome context
chr1: 1167863-1167952 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-200a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-200a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-200a-5p

Accession MIMAT0001620
Description Homo sapiens hsa-miR-200a-5p mature miRNA
Sequence 16 - CAUCUUACCGGACAGUGCUGGA - 37
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-200a-3p

Accession MIMAT0000682
Description Homo sapiens hsa-miR-200a-3p mature miRNA
Sequence 54 - UAACACUGUCUGGUAACGAUGU - 75
Evidence experimental
cloned [3-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  5. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706