miRBase entry: hsa-mir-219a-2

Stem-loop hsa-mir-219a-2


Accession
MI0000740
Symbol
HGNC: MIR219A2
Description
Homo sapiens hsa-mir-219a-2 precursor miRNA
Gene family
MIPF0000044; mir-219

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR219A2, a downregulated gene, is associated with clusters Oligo1 and Oligo2 in Alzheimer's disease (AD) [PMC6980793]. Oligodendrocytes in AD express fewer transcripts of genes involved in myelination, axonal guidance, and maturation of myelin-forming cells, including SEMA3B, STMN4, and MIR219A2 [PMC6980793]. MIR219A2 is a microRNA that plays a role in modulating oligodendrocyte differentiation and remyelination [PMC9822908]. It has been reported to be downregulated in the brains of Alzheimer's patients [PMC9822908]. The upregulated expression of microRNAs, including MIR219A2, in ALS-TD patients suggests transcriptional and translational dysregulation in these patients [PMC9822908].

Literature search
70 open access papers mention hsa-mir-219a-2
(247 sentences)

Sequence

149935 reads, 3045 reads per million, 66 experiments
acucaggggcuucgccacUGAUUGUCCAAACGCAAUUCUuguacgagucugcggccaaccgAGAAUUGUGGCUGGACAUCUGUggcugagcuccggg
.(((.(((((((.(((((.(((.(((((..(((((((((((...(.(((...))))...)))))))))))..)))))))).))))).))))))))))

Structure
a   a       c     U   U     AA           uac a   u 
 cuc ggggcuu gccac GAU GUCCA  CGCAAUUCUug   g guc  
 ||| ||||||| ||||| ||| |||||  |||||||||||   | ||| g
 ggg ccucgag cggUG CUA CAGGU  GUGUUAAGAgc   c cgg  
-   -       u     U   -     CG           caa -   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2].

Genome context
chr9: 128392618-128392714 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-219a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-219a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-219a-5p

Accession MIMAT0000276
Description Homo sapiens hsa-miR-219a-5p mature miRNA
Sequence 19 - UGAUUGUCCAAACGCAAUUCU - 39
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-219a-2-3p

Accession MIMAT0004675
Description Homo sapiens hsa-miR-219a-2-3p mature miRNA
Sequence 62 - AGAAUUGUGGCUGGACAUCUGU - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73