MIR219A2, a downregulated gene, is associated with clusters Oligo1 and Oligo2 in Alzheimer's disease (AD) [PMC6980793]. Oligodendrocytes in AD express fewer transcripts of genes involved in myelination, axonal guidance, and maturation of myelin-forming cells, including SEMA3B, STMN4, and MIR219A2 [PMC6980793]. MIR219A2 is a microRNA that plays a role in modulating oligodendrocyte differentiation and remyelination [PMC9822908]. It has been reported to be downregulated in the brains of Alzheimer's patients [PMC9822908]. The upregulated expression of microRNAs, including MIR219A2, in ALS-TD patients suggests transcriptional and translational dysregulation in these patients [PMC9822908].
a a c U U AA uac a u cuc ggggcuu gccac GAU GUCCA CGCAAUUCUug g guc ||| ||||||| ||||| ||| ||||| ||||||||||| | ||| g ggg ccucgag cggUG CUA CAGGU GUGUUAAGAgc c cgg - - u U - CG caa - c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000276 |
Description | Homo sapiens hsa-miR-219a-5p mature miRNA |
Sequence | 19 - UGAUUGUCCAAACGCAAUUCU - 39 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0004675 |
Description | Homo sapiens hsa-miR-219a-2-3p mature miRNA |
Sequence | 62 - AGAAUUGUGGCUGGACAUCUGU - 83 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|