WARNING: This summary was generated by AI. Hsa-mir-374, a microRNA detected in plasma, is implicated in a variety of diseases, including neurodegenerative disorders like Amyotrophic lateral sclerosis, Alzheimer's, and Parkinson's disease, as well as immune-related diseases such as T-cell acute lymphoid leukemia and inflammatory processes in diabetes [PMC9713411]. It is often used as a normalization control in miRNA expression studies alongside other miRNAs such as hsa-miR-16 and hsa-miR-425-5p [PMC4919505]. The expression of hsa-mir-374 has been observed to co-occur with hsa-miR-218 across various experiments [PMC3479204], and it is among the miRNAs abundantly expressed in day 9 neuronal progenitors [PMC3195087]. It has been identified as a potential biomarker for distinguishing between benign and malignant parotid neoplasms [PMC4636154] and is involved in the regulation of MECP2 expression, interferon signaling, oncogene-induced senescence, glycosaminoglycan metabolism, and granulopoiesis [PMC7582243]. Notably, hsa-mir-374 was upregulated in livers of patients with hepatitis C compared to those with primary biliary cirrhosis (PBC) [PMC7582243], suggesting its potential role as a biomarker for hepatic conditions. Furthermore, it has been implicated in the Wnt signaling pathway which is relevant to implantation processes during pregnancy [PMC5339930].
c c C u
uacau ggc aUUAUAAUACAA CUGAUAAGUGu a
||||| ||| |||||||||||| |||||||||||
augug cug UAAUGUUAUGUU GACUAUUCacg u
u U A a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000727 |
| Description | Homo sapiens hsa-miR-374a-5p mature miRNA |
| Sequence | 12 - UUAUAAUACAACCUGAUAAGUG - 33 |
| Evidence |
experimental
cloned [1-4], Northern [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004688 |
| Description | Homo sapiens hsa-miR-374a-3p mature miRNA |
| Sequence | 42 - CUUAUCAGAUUGUAUUGUAAUU - 63 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|