MIR374A is a microRNA that has been identified as a direct regulator of the p140Cap protein in lung, gastric, and cutaneous squamous carcinoma cells, linking miRNAs to epithelial cancer cell features through the inhibition of p140Cap expression [PMC5357316]. It is part of a panel of nine miRNAs, including miR-21, miR-218, miR-193b, miR-331, MIR374A, miR548c, miR520f, miR27b and miR-30b that have been associated with tumor volume and shown to have a 67% sensitivity and 80% specificity [PMC9965735]. MIR374A has also been detected in cerebrospinal fluid (CSF) samples from glioblastoma patients and found to correlate with levels detected from tissue biopsies [PMC7014190]. It has been associated with malignancy and identified as an independent predictor for LOFS (loss of fetal signal) when combined with MIR320b [PMC6196565]. In addition to its role in cancer cells, MIR374A has also been implicated in distinguishing hypoxic-ischemic encephalopathy (HIE) patients from healthy newborns and assessing the severity of HIE [PMC7296108]. Furthermore, MIR374A is involved in autophagy regulation by targeting RAB5A and UVRAG genes [PMC4389881]. Overall, MIR374A plays a role in various biological processes including cancer development and progression as well as HIE severity assessment.
c c C u uacau ggc aUUAUAAUACAA CUGAUAAGUGu a ||||| ||| |||||||||||| ||||||||||| augug cug UAAUGUUAUGUU GACUAUUCacg u u U A a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000727 |
Description | Homo sapiens hsa-miR-374a-5p mature miRNA |
Sequence | 12 - UUAUAAUACAACCUGAUAAGUG - 33 |
Evidence |
experimental
cloned [1-4], Northern [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004688 |
Description | Homo sapiens hsa-miR-374a-3p mature miRNA |
Sequence | 42 - CUUAUCAGAUUGUAUUGUAAUU - 63 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|