Stem-loop hsa-mir-382

Accession

MI0000790

Symbol

HGNC: MIR382

Description

Homo sapiens hsa-mir-382 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR382 is a microRNA implicated in various cellular processes and diseases, including ovarian cancer (OvCa), where it may modulate KIF14 mRNA levels and contribute to KIF14 mRNA overexpression in tumors [PMC3953446]. It also plays a role in epigenetic regulation by reducing SLC7A11 expression, thereby promoting ferroptosis [PMC8572460]. Furthermore, MIR382 is involved in cellular pathways by influencing the PI3K/AKT/mTOR pathway through the regulation of PTEN levels, which affects HIF-1α synthesis [PMC4081109]. In the context of viral infections, MIR382 expression has been shown to inhibit HIV-1 replication in macrophages [PMC4406127]. Additionally, overexpression of MIR382 can decrease ethanol intake and preference by influencing expression levels [PMC5836055]. In osteosarcomas, lower expression of MIR382 has been associated with poorer outcomes [PMC3953446], while its decreased exosomal expression was observed when HDAC3 was silenced in BMSCs [PMC6883144]. In psychiatric disorders such as schizophrenia and bipolar disorder, altered MIR382 levels have been reported in ON-derived cells and are consistent with changes observed in postmortem brain studies [PMC4354342]. Lastly, significant enrichment of MIR382 has been found in samples from high-fat diet groups, suggesting its involvement in dietary response mechanisms [PMC7527411].

Literature search

69 open access papers mention hsa-mir-382
(451 sentences)

Sequence

27144 reads, 57 reads per million, 86 experiments

uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuuaugacgAAUCAUUCACGGACAACACUUuuuucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure

    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuuuuUU  CAACAGGCACU  CUAAgc g   u
    -       CA           UA      a uau 

Annotation confidence Medium

Genome context

chr14: 101054306-101054381 [+]

Clustered miRNAs

14 other miRNAs are < 10 kb from hsa-mir-382

Disease association

hsa-mir-382 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-382-5p

• Accession: MIMAT0000737
• Description: Homo sapiens hsa-miR-382-5p mature miRNA
• Sequence: 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
• Evidence: experimental ; cloned [1-3]

Mature hsa-miR-382-3p

• Accession: MIMAT0022697
• Description: Homo sapiens hsa-miR-382-3p mature miRNA
• Sequence: 47 - AAUCAUUCACGGACAACACUU - 67
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267