Stem-loop rno-mir-185

Accession

MI0000930

Description

Rattus norvegicus rno-mir-185 precursor miRNA

Literature search

14 open access papers mention rno-mir-185
(175 sentences)

Sequence

36190 reads, 1155 reads per million, 486 experiments

gggggugagggauUGGAGAGAAAGGCAGUUCCUGAugguccccucccaggggcuggcUUUCCUCUGGUCCUUCUCUccca
(((((.((((((((((((.(((((.(((((((((..((......))))))))))).))))))))))))))))).))))).

Structure

-     u            A     G         Au  uc 
 ggggg gagggauUGGAG GAAAG CAGUUCCUG  gg  c
 ||||| |||||||||||| ||||| |||||||||  ||   
 cccUC CUUCCUGGUCUC CUUUc gucggggac  cc  c
a     U            -     g         --  uc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr11: 86812702-86812781 [+]

Mature rno-miR-185-5p

• Accession: MIMAT0000862
• Description: Rattus norvegicus rno-miR-185-5p mature miRNA
• Sequence: 14 - UGGAGAGAAAGGCAGUUCCUGA - 35
• Evidence: experimental ; cloned [1-3], SOLiD [4]

Mature rno-miR-185-3p

• Accession: MIMAT0017142
• Description: Rattus norvegicus rno-miR-185-3p mature miRNA
• Sequence: 58 - UUUCCUCUGGUCCUUCUCU - 76
• Evidence: experimental ; SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


4. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68