miRBase entry: rno-mir-191a

Stem-loop rno-mir-191a


Accession
MI0000934
Description
Rattus norvegicus rno-mir-191a precursor miRNA

Literature search
24 open access papers mention rno-mir-191a
(58 sentences)

Sequence

13586781 reads, 15419 reads per million, 510 experiments
ggcuggacagcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCACUUGGAUUUCGUUCCCugcucuccugccu
(((.(((.((((((.((((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))).)))))).))).))).

Structure
-   u   c      C          C  AA       --u   cu 
 ggc gga agcggg AACGGAAUCC AA  GCAGCUG   ugu  c
 ||| ||| |||||| |||||||||| ||  |||||||   |||  c
 ccg ccu ucguCC UUGCUUUAGG UU  CGUCGac   acg  a
u   u   c      C          -  CA       cuu   ag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr8: 117354364-117354454 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-191a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-191a-5p

Accession MIMAT0000866
Description Rattus norvegicus rno-miR-191a-5p mature miRNA
Sequence 15 - CAACGGAAUCCCAAAAGCAGCUG - 37
Evidence experimental
cloned [1-4], Northern [1,3], SOLiD [5]

Mature rno-miR-191a-3p

Accession MIMAT0017146
Description Rattus norvegicus rno-miR-191a-3p mature miRNA
Sequence 57 - GCUGCACUUGGAUUUCGUUCCC - 78
Evidence experimental
SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68