miRBase entry: rno-mir-196a

Stem-loop rno-mir-196a


Accession
MI0000940
Description
Rattus norvegicus rno-mir-196a precursor miRNA

Literature search
86 open access papers mention rno-mir-196a
(177 sentences)

Sequence

64212 reads, 140.0 reads per million, 270 experiments
uguuugcucagcugaucuguggcuUAGGUAGUUUCAUGUUGUUGGGauugaguuuugaacUCGGCAACAAGAAACUGCCUGAguuacaucagucgguuuucgucgagggc
.....(((((((((((.((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))...)))))))........))))

Structure
uguuu    --------       --c                  A          a  gag 
     gcuc        agcugau   uguggcuUAGGUAGUUUC UGUUGUUGGG uu   u
     ||||        |||||||   |||||||||||||||||| |||||||||| ||    
     cggg        uuggcug   acauugAGUCCGUCAAAG ACAACGGCUc aa   u
-----    agcugcuu       acu                  A          -  guu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 144584235-144584344 [+]

Database links

Mature rno-miR-196a-5p

Accession MIMAT0000871
Description Rattus norvegicus rno-miR-196a-5p mature miRNA
Sequence 25 - UAGGUAGUUUCAUGUUGUUGGG - 46
Evidence experimental
cloned [1,3], SOLiD [4]

Mature rno-miR-196a-3p

Accession MIMAT0004737
Description Rattus norvegicus rno-miR-196a-3p mature miRNA
Sequence 61 - UCGGCAACAAGAAACUGCCUGA - 82
Evidence experimental
cloned [3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 15105502
    MicroRNA-directed cleavage of HOXB8 mRNA
    "Yekta S, Shih IH, Bartel DP"
    "Science (2004) 304:594-596

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249