miRBase entry: ath-MIR169g

Stem-loop ath-MIR169g


Accession
MI0000981
Description
Arabidopsis thaliana ath-MIR169g precursor miRNA

Literature search
38 open access papers mention ath-MIR169g
(167 sentences)

Sequence

120706 reads, 537.0 reads per million, 184 experiments
ugccuauaaauaccuucaucacgaguaugacaagaucacaagacaagaaaagaaagguagagaaaacaugauaaugaugauuacgaugaugagagucucuaguuguaucagagggucuugcauggaagaauagagaaugagguUGAGCCAAGGAUGACUUGCCGgguuuuuuuaccaaugaaucuaauuaacugauucugguguccgGCAAGUUGACCUUGGCUCUGUUuccuucucuucuuuuggaugucagacuccaagauaucuaucaucaugaaucgugaucaaacuuuguaauuucauugaaauguguuuuucuugaugcgaauuuuuuggcuuacgguuuuucgauuugaaugaucagauuuuuguuuuugca
(((..(((((...((((((..(((((.(((.((((((..(((.(((((((........(((((((((((..(((((((((((((((((((((.((.........(((((...((((((.((((((((((..((((((.((((..(((((((((..(((((((((((......(((((..(((((.........)))))))))))))))))))))..)))))))))..)))).))))))))))))..)))).))))))...))))))).))))))....)))))))))............))))))..)))).))))))).........))))))).)))..)))))))))))))).))))..))...)))))....)))

Structure
   --cu     uac  --    ca     a   c      ac   a       -agaaaggu       -    ga      ------------         ----      g  ucucuaguu     aga      u    --      au      u    uU         AU           uuuuuu     au     uaa 
ugc    auaaa   cu  ucau  cgagu uga aagauc  aag caagaaa         agagaaa acau  uaauga            ugauuacga    ugauga ag         guauc   gggucu gcau  ggaaga  agagaa gagg  GAGCCAAGG  GACUUGCCGgg      uacca  gaauc   u
|||    |||||   ||  ||||  ||||| ||| ||||||  ||| |||||||         ||||||| ||||  ||||||            |||||||||    |||||| ||         |||||   |||||| ||||  ||||||  |||||| ||||  |||||||||  |||||||||||      |||||  |||||   u
acg    uguuu   ga  agua  guuua gcu uuuugg  uuc guuuuuu         ucuuuuu ugua  guuacu            acuagugcu    acuacu uc         uauag   cucaga ugua  uuuucu  ucucuu cuUU  CUCGGUUCC  UUGAACGgccu      guggu  cuuag   a
   uuuu     uua  cu    -a     -   -      ca   g       aagcguagu       g    aa      uuaauguuucaa         aagu      a  ---------     aac      c    gg      --      c    GU         AG           ------     --     uca 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [3,4]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors. Wang et al. report Northern blot evidence for the miR169* sequence from the opposite arm of the precursor [2].

Genome context
chr4: 11482879-11483257 [-]

Database links

Mature ath-miR169g-5p

Accession MIMAT0000911
Description Arabidopsis thaliana ath-miR169g-5p mature miRNA
Sequence 144 - UGAGCCAAGGAUGACUUGCCG - 164
Evidence experimental
cloned [3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR169g-3p

Accession MIMAT0000912
Description Arabidopsis thaliana ath-miR169g-3p mature miRNA
Sequence 208 - GCAAGUUGACCUUGGCUCUGUU - 229
Evidence experimental
Northern [2], 454 [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15345049
    Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
    Wang XJ, Reyes JL, Chua NH, Gaasterland T
    Genome Biol (2004) 5:R65

  6. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799