Stem-loop ath-MIR169g

Accession

MI0000981

Description

Arabidopsis thaliana ath-MIR169g precursor miRNA

Literature search

35 open access papers mention ath-MIR169g
(160 sentences)

Sequence

ugccuauaaauaccuucaucacgaguaugacaagaucacaagacaagaaaagaaagguagagaaaacaugauaaugaugauuacgaugaugagagucucuaguuguaucagagggucuugcauggaagaauagagaaugagguUGAGCCAAGGAUGACUUGCCGgguuuuuuuaccaaugaaucuaauuaacugauucuggugUCCGGCAAGUUGACCUUGGCUcuguuuccuucucuucuuuuggaugucagacuccaagauaucuaucaucaugaaucgugaucaaacuuuguaauuucauugaaauguguuuuucuugaugcgaauuuuuuggcuuacgguuuuucgauuugaaugaucagauuuuuguuuuugca
(((..(((((...((((((..(((((.(((.((((((..(((.(((((((........(((((((((((..(((((((((((((((((((((.((.........(((((...((((((.((((((((((..((((((.((((..(((((((((..(((((((((((......(((((..(((((.........)))))))))))))))))))))..)))))))))..)))).))))))))))))..)))).))))))...))))))).))))))....)))))))))............))))))..)))).))))))).........))))))).)))..)))))))))))))).))))..))...)))))....)))

Structure

   --cu     uac  --    ca     a   c      ac   a       -agaaaggu       -    ga      ------------         ----      g  ucucuaguu     aga      u    --      au      u    uU         AU           uuuuuu     au     uaa 
ugc    auaaa   cu  ucau  cgagu uga aagauc  aag caagaaa         agagaaa acau  uaauga            ugauuacga    ugauga ag         guauc   gggucu gcau  ggaaga  agagaa gagg  GAGCCAAGG  GACUUGCCGgg      uacca  gaauc   u
|||    |||||   ||  ||||  ||||| ||| ||||||  ||| |||||||         ||||||| ||||  ||||||            |||||||||    |||||| ||         |||||   |||||| ||||  ||||||  |||||| ||||  |||||||||  |||||||||||      |||||  |||||   u
acg    uguuu   ga  agua  guuua gcu uuuugg  uuc guuuuuu         ucuuuuu ugua  guuacu            acuagugcu    acuacu uc         uauag   cucaga ugua  uuuucu  ucucuu cuuu  cUCGGUUCC  UUGAACGGCCU      guggu  cuuag   a
   uuuu     uua  cu    -a     -   -      ca   g       aagcguagu       g    aa      uuaauguuucaa         aagu      a  ---------     aac      c    gg      --      c    gu         AG           ------     --     uca 

Annotation confidence Not enough data

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [3,4]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors. Wang et al. report Northern blot evidence for the miR169* sequence from the opposite arm of the precursor [2].

Genome context

chr4: 11482879-11483257 [-]

Mature ath-miR169g-5p

• Accession: MIMAT0000911
• Description: Arabidopsis thaliana ath-miR169g-5p mature miRNA
• Sequence: 144 - UGAGCCAAGGAUGACUUGCCG - 164
• Evidence: experimental ; cloned [3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR169g-3p

• Accession: MIMAT0000912
• Description: Arabidopsis thaliana ath-miR169g-3p mature miRNA
• Sequence: 204 - UCCGGCAAGUUGACCUUGGCU - 224
• Evidence: experimental ; Northern [2], 454 [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15345049
   Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
   Wang XJ, Reyes JL, Chua NH, Gaasterland T
   Genome Biol (2004) 5:R65


6. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799