Stem-loop ath-MIR169i

Accession

MI0000983

Description

Arabidopsis thaliana ath-MIR169i precursor miRNA

Literature search

36 open access papers mention ath-MIR169i
(164 sentences)

Sequence

85122 reads, 1076.0 reads per million, 171 experiments

gaaggagaugucaaagaugaauagaagaaucauauuuggUAGCCAAGGAUGACUUGCCUGAcucuuuguguaaaauguuuagugucuuguuugaagucacuauaaguuguaucaagcaaugaccauuuugcuuauaaaaaagauaucAGGCAGUCUCCUUGGCUAUCCUuauauguucuucucuuucaucucagacauucaccuuc
(((((.((((((..(((((((.(((((((.(((((..((((((((((((.((((.((((((.(((((..((((((((......(((((((((((....(((...)))....)))))))).))))))))))).......)))))..)))))))))))))))))))).))..))))))))))))..)))))))..))))))..)))))

Structure

     -a      aa       -u       u     uu  -          U    U      -c     -----gu        uuuagu   -        aguc   a 
gaagg  gauguc  agaugaa  agaagaa cauau  gg UAGCCAAGGA GACU GCCUGA  ucuuu       guaaaaug      guc uuguuuga    acu  
|||||  ||||||  |||||||  ||||||| |||||  || |||||||||| |||| ||||||  |||||       ||||||||      ||| ||||||||    ||| u
cuucc  uuacag  ucuacuu  ucuucuu guaua  CC AUCGGUUCCU CUGA CGGAcu  agaaa       cguuuuac      cag aacgaacu    uga  
     ac      ac       uc       -     uU  U          -    -      au     aaauauu        ------   u        augu   a 

Annotation confidence High

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

chr3: 9871960-9872165 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from ath-MIR169i

Mature ath-miR169i-5p

• Accession: MIMAT0000914
• Description: Arabidopsis thaliana ath-miR169i-5p mature miRNA
• Sequence: 40 - UAGCCAAGGAUGACUUGCCUGA - 61
• Evidence: experimental ; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

Mature ath-miR169i-3p

• Accession: MIMAT0053812
• Description: Arabidopsis thaliana ath-miR169i-3p mature miRNA
• Sequence: 148 - AGGCAGUCUCCUUGGCUAUCCU - 169
• Evidence: experimental ; unknown

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799