Stem-loop ath-MIR169l

Accession

MI0000986

Description

Arabidopsis thaliana ath-MIR169l precursor miRNA

Literature search

35 open access papers mention ath-MIR169l
(167 sentences)

Sequence

85025 reads, 755.0 reads per million, 163 experiments

augaagaagagaggucuaauauggcgaaaagagucauguuuaAUAGCCAAGGAUGACUUGCCUGaucuuuuucaccuccaugauucaauuuuaaguucguggauuuuggauuauuaugcguuuaaaagguauaauaauuugagaucauguugaaucuugcggguuagguuucAGGCAGUCUCUUUGGCUAUCUugacaugcuuucuucauc
.....(((((((((((.((((((((.......))))))))..(((((((((((.((((.((((((....(((.((((.((.((((((((............((((((((((((((((((.((...)).))))))))))))))))))..)))))))).)).)))).)))..)))))))))))))))))))))...)))...))))))))...

Structure

augaa        ---   uaauauggcgaaaagagucauguuua           U    U      ucuu   c    c  u        uuuaaguucgug                  g  u 
     gaagagag   guc                          AUAGCCAAGGA GACU GCCUGa    uuu accu ca gauucaau            gauuuuggauuauuaugc uu  
     ||||||||   |||                          ||||||||||| |||| ||||||    ||| |||| || ||||||||            |||||||||||||||||| || a
     cuucuuuc   cag                          UAUCGGUUUCU CUGA CGGAcu    gga uggg gu cuaaguug            cuagaguuuaauaauaug aa  
--cua        gua   -----------------------uUC           -    -      --uu   u    c  u        ----------ua                  g  a 

Annotation confidence High

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

chr3: 9875893-9876103 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from ath-MIR169l

Mature ath-miR169l-5p

• Accession: MIMAT0000917
• Description: Arabidopsis thaliana ath-miR169l-5p mature miRNA
• Sequence: 43 - AUAGCCAAGGAUGACUUGCCUG - 64
• Evidence: experimental ; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

Mature ath-miR169l-3p

• Accession: MIMAT0053815
• Description: Arabidopsis thaliana ath-miR169l-3p mature miRNA
• Sequence: 173 - AGGCAGUCUCUUUGGCUAUCU - 193
• Evidence: experimental ; unknown

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799