Stem-loop ath-MIR394a

Accession

MI0001005

Description

Arabidopsis thaliana ath-MIR394a precursor miRNA

Literature search

12 open access papers mention ath-MIR394a
(24 sentences)

Sequence

cuuacagucaucuUUGGCAUUCUGUCCACCUCCuucuauacauauaugcauguguauauauauaugcguuucgugugaaagaaggagguggguauacugccaauagagaucuguuag
((.((((((.(((((((((...(((((((((((((((.(((((..((((((((((....))))))))))...)))))..)))))))))))))))...)))))).))))).)))).))

Structure

  u    -  a   -      UUC               -a     -au          a 
cu acag uc ucu UUGGCA   UGUCCACCUCCuucu  uacau   augcaugugu u
|| |||| || ||| ||||||   |||||||||||||||  |||||   ||||||||||  
ga uguc ag aga aaccgu   auggguggaggaaga  gugug   ugcguauaua a
  u    u  -   u      cau               aa     cuu          u 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1].

Genome context

chr1: 7058194-7058310 [+]

Mature ath-miR394a

• Accession: MIMAT0000936
• Description: Arabidopsis thaliana ath-miR394a mature miRNA
• Sequence: 14 - UUGGCAUUCUGUCCACCUCC - 33
• Evidence: experimental ; 5'RACE [1-2], Northern [1], PCR [1], 454 [3], MPSS [3]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799