Stem-loop osa-MIR171c

Accession

MI0001134

Description

Oryza sativa osa-MIR171c precursor miRNA

Literature search

45 open access papers mention osa-MIR171c
(246 sentences)

Sequence

7084876 reads, 32343.0 reads per million, 142 experiments

gugggaacgggAUAUUGGUGCGGUUCAAUCAgaaagcuugugcuccgaaggcgaggggcuccacucuuUGAUUGAGCCGUGCCAAUAUcacgucgccuu
..((..(((.(((((((((((((((((((((((.((.....(((((........)))))....)).))))))))))))))))))))))).)))..))..

Structure

gu  ga   g                       a  cuugu     gaa 
  gg  acg gAUAUUGGUGCGGUUCAAUCAga ag     gcucc   g
  ||  ||| ||||||||||||||||||||||| ||     |||||    
  cc  ugc cUAUAACCGUGCCGAGUUAGUuu uc     cgggg   g
uu  gc   a                       c  -accu     agc 

Annotation confidence High

Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context

4: 31713472-31713570 [-]

Mature osa-miR171c-5p

• Accession: MIMAT0022877
• Description: Oryza sativa osa-miR171c-5p mature miRNA
• Sequence: 12 - AUAUUGGUGCGGUUCAAUCA - 31
• Evidence: experimental ; Illumina [2]

Mature osa-miR171c-3p

• Accession: MIMAT0001064
• Description: Oryza sativa osa-miR171c-3p mature miRNA
• Sequence: 69 - UGAUUGAGCCGUGCCAAUAU - 88
• Evidence: not_experimental

References

1. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


2. PubMed ID: 21901091
   Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors
   Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y
   PLoS Pathog (2011) 7:e1002176