miRBase entry: hsa-mir-429

Stem-loop hsa-mir-429


Accession
MI0001641
Symbol
HGNC: MIR429
Description
Homo sapiens hsa-mir-429 precursor miRNA mir-8
Gene
family?
RF00241; mir-8

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR429 is a microRNA that has been identified as a regulator of cellular processes in various carcinomas, including those of the endometrial, prostate, and breast tissues [PMC9866967]. It is one of several microRNAs, including MIR200A, MIR200B, MIR200C, and MIR25 that have been previously reported in the literature [PMC6701281]. Specifically, MIR429 has been shown to influence the proliferation and invasion capabilities of cancer cells in these carcinomas [PMC9866967]. This suggests that MIR429 may play a significant role in cancer progression and could potentially serve as a target for therapeutic intervention.

Literature search
194 open access papers mention hsa-mir-429
(660 sentences)

Sequence

33901 reads, 92 reads per million, 96 experiments
cgccggccgaugggcgucuuaccagacaugguuagaccuggcccucugucUAAUACUGUCUGGUAAAACCGUccauccgcugc
...((((.((((((((..((((((((((..(((((((..........)))))))..))))))))))...)))))))).)))).

Structure
cgc    c        -uc          ug       cugg 
   cggc gaugggcg   uuaccagaca  guuagac    c
   |||| ||||||||   ||||||||||  |||||||     
   gucg cuaccUGC   AAUGGUCUGU  UAAUcug    c
--c    c        CAA          CA       ucuc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244).

Genome context
chr1: 1169005-1169087 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-429
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-429 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-429

Accession MIMAT0001536
Description Homo sapiens hsa-miR-429 mature miRNA
Sequence 51 - UAAUACUGUCUGGUAAAACCGU - 72
Evidence experimental
cloned [1-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  4. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345