MIR429 is a microRNA that has been identified as a regulator of cellular processes in various carcinomas, including those of the endometrial, prostate, and breast tissues [PMC9866967]. It is one of several microRNAs, including MIR200A, MIR200B, MIR200C, and MIR25 that have been previously reported in the literature [PMC6701281]. Specifically, MIR429 has been shown to influence the proliferation and invasion capabilities of cancer cells in these carcinomas [PMC9866967]. This suggests that MIR429 may play a significant role in cancer progression and could potentially serve as a target for therapeutic intervention.
cgc c -uc ug cugg cggc gaugggcg uuaccagaca guuagac c |||| |||||||| |||||||||| ||||||| gucg cuaccUGC AAUGGUCUGU UAAUcug c --c c CAA CA ucuc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001536 |
Description | Homo sapiens hsa-miR-429 mature miRNA |
Sequence | 51 - UAAUACUGUCUGGUAAAACCGU - 72 |
Evidence |
experimental
cloned [1-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|