WARNING: This summary was generated by AI. MIR452, a microRNA, was observed to be upregulated in colorectal cancer (CRC) tissues and in tissues affected by dextran sulfate sodium (DSS)-induced colitis, suggesting a role in inflammatory and cancer processes [PMC6826374]. This upregulation implicates MIR452 in the modulation of critical signaling pathways within CRC cells, specifically the VEGFA–VEGFR2-mediated pathways, which include VEGFR2–SRC–PTK2 and VEGFR2–KRAS–BRAF–MAPK [PMC6826374]. Through its regulation of these pathways, MIR452 influences CRC cell growth, migration, and angiogenesis [PMC6826374]. Experimental evidence supporting the regulatory role of MIR452 was provided by a reduction in luciferase activity by about 15% when CRC cells were co-transfected with a MIR452 mimic [PMC6826374]. This finding underscores the potential of MIR452 as a therapeutic target or biomarker for CRC due to its involvement in key cellular processes that drive tumor progression [PMC6826374].
u AAC G G A uuug gc aagcacuuac U UUUGCAGA GA ACUGAGAc u || |||||||||| | |||||||| || |||||||| a cg uucgugaaUG A AAACGUCU CU UGACUcug a u --A G A C uauc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001635 |
| Description | Homo sapiens hsa-miR-452-5p mature miRNA |
| Sequence | 14 - AACUGUUUGCAGAGGAAACUGAGA - 37 |
| Evidence |
experimental
cloned [1,3-5], array-cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0001636 |
| Description | Homo sapiens hsa-miR-452-3p mature miRNA |
| Sequence | 53 - UCAGUCUCAUCUGCAAAGAAGU - 74 |
| Evidence |
experimental
array-cloned [2], cloned [4] |
| Database links |
|
| Predicted targets |
|
|