miRBase entry: hsa-mir-452

Stem-loop hsa-mir-452


Accession
MI0001733
Symbol
HGNC: MIR452
Description
Homo sapiens hsa-mir-452 precursor miRNA mir-452
Gene
family?
RF00839; mir-452

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR452, a microRNA, was observed to be upregulated in colorectal cancer (CRC) tissues and in tissues affected by dextran sulfate sodium (DSS)-induced colitis, suggesting a role in inflammatory and cancer processes [PMC6826374]. This upregulation implicates MIR452 in the modulation of critical signaling pathways within CRC cells, specifically the VEGFA–VEGFR2-mediated pathways, which include VEGFR2–SRC–PTK2 and VEGFR2–KRAS–BRAF–MAPK [PMC6826374]. Through its regulation of these pathways, MIR452 influences CRC cell growth, migration, and angiogenesis [PMC6826374]. Experimental evidence supporting the regulatory role of MIR452 was provided by a reduction in luciferase activity by about 15% when CRC cells were co-transfected with a MIR452 mimic [PMC6826374]. This finding underscores the potential of MIR452 as a therapeutic target or biomarker for CRC due to its involvement in key cellular processes that drive tumor progression [PMC6826374].

Literature search
125 open access papers mention hsa-mir-452
(600 sentences)

Sequence

225852 reads, 242.0 reads per million, 163 experiments
gcuaagcacuuacAACUGUUUGCAGAGGAAACUGAGAcuuuguaacuaugucUCAGUCUCAUCUGCAAAGAAGUaagugcuuugc
((.((((((((((...(.((((((((.((.((((((((...........)))))))).)).)))))))).).)))))))))).))

Structure
  u          AAC G        G  A        uuug 
gc aagcacuuac   U UUUGCAGA GA ACUGAGAc    u
|| ||||||||||   | |||||||| || ||||||||    a
cg uucgugaaUG   A AAACGUCU CU UGACUcug    a
  u          --A G        A  C        uauc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chrX: 151959628-151959712 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-452
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-452 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-452-5p

Accession MIMAT0001635
Description Homo sapiens hsa-miR-452-5p mature miRNA
Sequence 14 - AACUGUUUGCAGAGGAAACUGAGA - 37
Evidence experimental
cloned [1,3-5], array-cloned [2]
Database links
Predicted targets

Mature hsa-miR-452-3p

Accession MIMAT0001636
Description Homo sapiens hsa-miR-452-3p mature miRNA
Sequence 53 - UCAGUCUCAUCUGCAAAGAAGU - 74
Evidence experimental
array-cloned [2], cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  4. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267