Stem-loop hsa-mir-452

Accession

MI0001733

Symbol

HGNC: MIR452

Description

Homo sapiens hsa-mir-452 precursor miRNA

Gene family

MIPF0000287; mir-452

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR452, a microRNA, has been found to be upregulated in both colorectal cancer (CRC) and dextran sulfate sodium (DSS)-induced mouse colitis tissues [PMC6826374]. It has been shown to regulate two VEGFA-VEGFR2-mediated signaling pathways, namely VEGFR2-SRC-PTK2 and VEGFR2-KRAS-BRAF-MAPK [PMC6826374]. Through these pathways, MIR452 has been found to regulate cell growth, cell migration, and angiogenesis in CRC cells via the VEGFA-VEGFR2 pathway [PMC6826374]. Additionally, when cells were co-transfected with a MIR452 mimic, the luciferase intensity was reduced by approximately 15% [PMC6826374]. Reference: [PMC6826374] Zhang YF et al. (2019) MIR452 regulates cell growth and angiogenesis through targeting of the VEGFA-VEGFR2 signaling pathway in colorectal cancer. World J Gastroenterol 25(43):6419-6433.

Literature search

48 open access papers mention hsa-mir-452
(270 sentences)

Sequence

41327 reads, 581 reads per million, 109 experiments

gcuaagcacuuacAACUGUUUGCAGAGGAAACUGAgacuuuguaacuaugucucaguCUCAUCUGCAAAGAAGUAAGUGcuuugc
((.((((((((((...(.((((((((.((.((((((((...........)))))))).)).)))))))).).)))))))))).))

Structure

  u          AAC G        G  A        uuug 
gc aagcacuuac   U UUUGCAGA GA ACUGAgac    u
|| ||||||||||   | |||||||| || ||||||||    a
cg uucGUGAAUG   A AAACGUCU CU ugacucug    a
  u          --A G        A  C        uauc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chrX: 151959628-151959712 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-452

Disease association

hsa-mir-452 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-452-5p

• Accession: MIMAT0001635
• Description: Homo sapiens hsa-miR-452-5p mature miRNA
• Sequence: 14 - AACUGUUUGCAGAGGAAACUGA - 35
• Evidence: experimental ; cloned [1,3-5], array-cloned [2]

Mature hsa-miR-452-3p

• Accession: MIMAT0001636
• Description: Homo sapiens hsa-miR-452-3p mature miRNA
• Sequence: 58 - CUCAUCUGCAAAGAAGUAAGUG - 79
• Evidence: experimental ; array-cloned [2], cloned [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


4. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267