miRBase entry: ptc-MIR171g

Stem-loop ptc-MIR171g


Accession
MI0002283
Description
Populus trichocarpa ptc-MIR171g precursor miRNA

Literature search
6 open access papers mention ptc-MIR171g
(11 sentences)

Sequence


gaaagugggggaUGUUGGGAUGGCUCAAUCAUGucaaaucucccaaauuaugauguugggucuuuuaaucUGAUUGAGCCGUGCCAAUAUCacacuucuu
..(((((...((((((((.((((((((((((.((.(((...(((((.........)))))...))).)).)))))))))))).)))))))).)))))...

Structure
-ga     ggg        G            U  c   ucu     auu 
   aagug   gaUGUUGG AUGGCUCAAUCA Gu aaa   cccaa   a
   |||||   |||||||| |||||||||||| || |||   |||||   u
   uucac   CUAUAACC UGCCGAGUUAGU ua uuu   ggguu   g
uuc     --a        G            c  a   ucu     gua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
CM000348.2: 11044609-11044708 [+]

Database links

Mature ptc-miR171g-3p

Accession MIMAT0001989
Description Populus trichocarpa ptc-miR171g-3p mature miRNA
Sequence 71 - UGAUUGAGCCGUGCCAAUAUC - 91
Evidence experimental
cloned [1], miRNAseq [3]

Mature ptc-miR171g-5p

Accession MIMAT0022902
Description Populus trichocarpa ptc-miR171g-5p mature miRNA
Sequence 13 - UGUUGGGAUGGCUCAAUCAUG - 33
Evidence experimental
miRNAseq [3]

References

  1. PubMed ID: 16973872
    The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)
    "Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm"
    "Science (2006) 313:1596-1604

  2. PubMed ID: 15994906
    Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis
    "Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL"
    "Plant Cell (2005) 17:2186-2203

  3. PubMed ID: 22442676
    Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets
    Puzey JR, Karger A, Axtell M, Kramer EM
    PLoS One (2012) 7:e33034