miRBase entry: mmu-mir-485

Stem-loop mmu-mir-485


Accession
MI0003492
Symbol
MGI: Mir485
Description
Mus musculus mmu-mir-485 precursor miRNA mir-485
Gene
family?
RF04296; mir-485

Literature search
19 open access papers mention mmu-mir-485
(31 sentences)

Sequence

37512 reads, 218 reads per million, 84 experiments
acuuggagAGAGGCUGGCCGUGAUGAAUUCgauucaucuaaacgAGUCAUACACGGCUCUCCUCUCuucuagu
(((.(((((((((..(((((((((((.((((...........)))))))).)))))))..))))))))).)))

Structure
   u         CU       -    A    auuc 
acu ggagAGAGG  GGCCGUG AUGA UUCg    a
||| |||||||||  ||||||| |||| ||||    u
uga cuuCUCUCC  UCGGCAC UACU GAgc    c
   u         UC       A    -    aaau 


Annotation confidence Low
Do you think this miRNA is real?
Comments
miR-485-3p was predicted by Sewer et al [1], and its expression later verified experimentally by Mineno et al using MPSS technology [2]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. Landgraf et al. show that the 5' product is the predominant one [3].

Genome context
chr12: 109734902-109734974 [+]
Clustered miRNAs
16 other miRNAs are < 10 kb from mmu-mir-485
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-485-5p

Accession MIMAT0003128
Description Mus musculus mmu-miR-485-5p mature miRNA
Sequence 9 - AGAGGCUGGCCGUGAUGAAUUC - 30
Evidence experimental
cloned [1,3], MPSS [2], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-485-3p

Accession MIMAT0003129
Description Mus musculus mmu-miR-485-3p mature miRNA
Sequence 45 - AGUCAUACACGGCUCUCCUCUC - 66
Evidence experimental
MPSS [2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267