Stem-loop mmu-mir-542

Accession

MI0003522

Symbol

MGI: Mir542

Description

Mus musculus mmu-mir-542 precursor miRNA mir-542

Gene
family

RF00755; mir-542

Literature search

22 open access papers mention mmu-mir-542
(154 sentences)

Sequence

43807 reads, 228 reads per million, 106 experiments

ggaucucagacguCUCGGGGAUCAUCAUGUCACGAgauaccacugugcccuUGUGACAGAUUGAUAACUGAAAggucugggagcc
((.((((((((.(.((((..((((...(((((((((.(((....)))..)))))))))...))))..)))).).)))))))).))

Structure

  a        g C    GG    UCA         -a   c 
gg ucucagac u UCGG  AUCA   UGUCACGAg  uac a
|| |||||||| | ||||  ||||   |||||||||  |||  
cc agggucug A AGUC  UAGU   ACAGUGUuc  gug c
  g        g A    AA    UAG         cc   u 

Annotation confidence Medium

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chrX: 53049403-53049487 [-]

Clustered miRNAs

6 other miRNAs are < 10 kb from mmu-mir-542

Mature mmu-miR-542-5p

• Accession: MIMAT0003171
• Description: Mus musculus mmu-miR-542-5p mature miRNA
• Sequence: 14 - CUCGGGGAUCAUCAUGUCACGA - 35
• Evidence: experimental ; cloned [1,4], miRAP-cloned [3], Illumina [5]

Mature mmu-miR-542-3p

• Accession: MIMAT0003172
• Description: Mus musculus mmu-miR-542-3p mature miRNA
• Sequence: 52 - UGUGACAGAUUGAUAACUGAAA - 73
• Evidence: experimental ; cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


6. PubMed ID: 16973894
   Mouse microRNA profiles determined with a new and sensitive cloning method
   "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
   "Nucleic Acids Res (2006) 34:e115