miRBase entry: hsa-mir-542

Stem-loop hsa-mir-542


Accession
MI0003686
Symbol
HGNC: MIR542
Description
Homo sapiens hsa-mir-542 precursor miRNA mir-542
Gene
family?
RF00755; mir-542

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR542 is a microRNA implicated in the regulation of tumor suppressive functions in glioblastoma multiforme (GBM) [PMC7575175]. It has been identified as a potential tumor suppressor, with its expression affecting the migration and proliferation of U251 glioma cells [PMC7575175]. MIR542 targets the AEG-1 gene, which is involved in the epithelial-mesenchymal transition (EMT) process, and downregulation of AEG-1 by MIR542 leads to a suppression of EMT, thereby inhibiting U251 cell aggressiveness and proliferation [PMC7575175]. The functional role of MIR542 in GBM and its underlying mechanisms are not fully understood; however, it has been shown to play a regulatory role in cancer development [PMC7575175]. The identification of targeted genes such as AEG-1 by MIR542 provides new insights into its role in tumor suppression and offers potential therapeutic targets for glioma treatment [PMC7575175].

Literature search
52 open access papers mention hsa-mir-542
(251 sentences)

Sequence

41785 reads, 171 reads per million, 112 experiments
cagaucucagacaucUCGGGGAUCAUCAUGUCACGAGAuaccagugugcacuUGUGACAGAUUGAUAACUGAAAggucugggagccacucaucuuca
....((((((((...((((..((((...(((((((((.(((....)))..)))))))))...))))..))))...))))))))..............

Structure
----------caga        auc    GG    UCA         -A   c 
              ucucagac   UCGG  AUCA   UGUCACGAG  uac a
              ||||||||   ||||  ||||   |||||||||  |||  
              agggucug   AGUC  UAGU   ACAGUGUuc  gug g
acuucuacucaccg        gAA    AA    UAG         ac   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 134541341-134541437 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-542
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-542 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-542-5p

Accession MIMAT0003340
Description Homo sapiens hsa-miR-542-5p mature miRNA
Sequence 16 - UCGGGGAUCAUCAUGUCACGAGA - 38
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-542-3p

Accession MIMAT0003389
Description Homo sapiens hsa-miR-542-3p mature miRNA
Sequence 53 - UGUGACAGAUUGAUAACUGAAA - 74
Evidence experimental
cloned [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267