Stem-loop hsa-mir-1301

Accession

MI0003815

Symbol

HGNC: MIR1301

Description

Homo sapiens hsa-mir-1301 precursor miRNA mir-1301

Gene
family

RF03292; mir-1301

Literature search

10 open access papers mention hsa-mir-1301
(16 sentences)

Sequence

17418 reads, 206 reads per million, 122 experiments

ggauugugggggguCGCUCUAGGCACCGCAGCAcugugcuggggaugUUGCAGCUGCCUGGGAGUGACUUCacacaguccuc
((((((((.(((((((((((((((((.((((((((.......)).)))))).).))))).))))))))))).))))))))..

Structure

--        g           -     - C      -  gu 
  ggauugug gggguCGCUCU AGGCA C GCAGCA cu  g
  |||||||| ||||||||||| ||||| | |||||| ||  c
  ccugacac CUUCAGUGAGG UCCGU G CGUUgu gg  u
cu        a           G     C A      a  gg 

Annotation confidence High

Genome context

chr2: 25328640-25328721 [-]

Disease association

hsa-mir-1301 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-1301-3p

• Accession: MIMAT0005797
• Description: Homo sapiens hsa-miR-1301-3p mature miRNA
• Sequence: 48 - UUGCAGCUGCCUGGGAGUGACUUC - 71
• Evidence: experimental ; Illumina [2,5], 454 [3-4]

Mature hsa-miR-1301-5p

• Accession: MIMAT0026639
• Description: Homo sapiens hsa-miR-1301-5p mature miRNA
• Sequence: 15 - CGCUCUAGGCACCGCAGCA - 33
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 19144710
   Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
   "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
   "J Virol (2009) 83:3333-3341


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


3. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621


4. PubMed ID: 19508715
   Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
   Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
   BMC Med Genomics (2009) 2:35


5. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45