miRBase entry: mmu-mir-744

Stem-loop mmu-mir-744


Accession
MI0004124
Symbol
MGI: Mir744
Description
Mus musculus mmu-mir-744 precursor miRNA mir-744
Gene
family?
RF00936; mir-744

Literature search
21 open access papers mention mmu-mir-744
(143 sentences)

Sequence

594831 reads, 1669 reads per million, 106 experiments
ggcugggcaaggUGCGGGGCUAGGGCUAACAGCAgucuuacugacgguuuccuggaaaccacacacaugCUGUUGCCACUAACCUCAACCUuacucgguc
(((((((.(((((..((((.((((((.((((((((((.....)))((((((...)))))).......)))))))))).))).)))).))))).)))))))

Structure
       c     GC    C   -   U       gucuuacugac      c 
ggcuggg aaggU  GGGG UAG GGC AACAGCA           gguuuc  
||||||| |||||  |||| ||| ||| |||||||           |||||| u
cuggcuc uUCCA  CUCC AUC CCG UUGUCgu           ccaaag  
       a     -A    A   A   -       ----acacaca      g 


Annotation confidence High
Do you think this miRNA is real?
Comments
mir-744 was also named mir-803 in Takada et al., supplementary information [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr11: 65734733-65734832 [-]

Database links

Mature mmu-miR-744-5p

Accession MIMAT0004187
Description Mus musculus mmu-miR-744-5p mature miRNA
Sequence 13 - UGCGGGGCUAGGGCUAACAGCA - 34
Evidence experimental
miRAP-cloned [1], cloned [2-3], 454 [4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-744-3p

Accession MIMAT0004820
Description Mus musculus mmu-miR-744-3p mature miRNA
Sequence 70 - CUGUUGCCACUAACCUCAACCU - 91
Evidence experimental
cloned [3], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115

  6. PubMed ID: 17989215
    RNA sequence analysis defines Dicer's role in mouse embryonic stem cells
    "Calabrese JM, Seila AC, Yeo GW, Sharp PA"
    "Proc Natl Acad Sci U S A (2007) 104:18097-18102