Stem-loop mmu-mir-744

Accession

MI0004124

Symbol

MGI: Mir744

Description

Mus musculus mmu-mir-744 precursor miRNA mir-744

Gene
family

RF00936; mir-744

Literature search

21 open access papers mention mmu-mir-744
(143 sentences)

Sequence

594831 reads, 1501 reads per million, 106 experiments

ggcugggcaaggUGCGGGGCUAGGGCUAACAGCAgucuuacugacgguuuccuggaaaccacacacaugCUGUUGCCACUAACCUCAACCUuacucgguc
(((((((.(((((..((((.((((((.((((((((((.....)))((((((...)))))).......)))))))))).))).)))).))))).)))))))

Structure

       c     GC    C   -   U       gucuuacugac      c 
ggcuggg aaggU  GGGG UAG GGC AACAGCA           gguuuc  
||||||| |||||  |||| ||| ||| |||||||           |||||| u
cuggcuc uUCCA  CUCC AUC CCG UUGUCgu           ccaaag  
       a     -A    A   A   -       ----acacaca      g 

Annotation confidence Medium

Comments

mir-744 was also named mir-803 in Takada et al., supplementary information [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr11: 65734733-65734832 [-]

Mature mmu-miR-744-5p

• Accession: MIMAT0004187
• Description: Mus musculus mmu-miR-744-5p mature miRNA
• Sequence: 13 - UGCGGGGCUAGGGCUAACAGCA - 34
• Evidence: experimental ; miRAP-cloned [1], cloned [2-3], 454 [4], Illumina [5-6]

Mature mmu-miR-744-3p

• Accession: MIMAT0004820
• Description: Mus musculus mmu-miR-744-3p mature miRNA
• Sequence: 70 - CUGUUGCCACUAACCUCAACCU - 91
• Evidence: experimental ; cloned [3], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 16973894
   Mouse microRNA profiles determined with a new and sensitive cloning method
   "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
   "Nucleic Acids Res (2006) 34:e115


6. PubMed ID: 17989215
   RNA sequence analysis defines Dicer's role in mouse embryonic stem cells
   "Calabrese JM, Seila AC, Yeo GW, Sharp PA"
   "Proc Natl Acad Sci U S A (2007) 104:18097-18102