miRBase entry: mmu-mir-666

Stem-loop mmu-mir-666


Accession
MI0004553
Symbol
MGI: Mir666
Description
Mus musculus mmu-mir-666 precursor miRNA mir-666
Gene
family?
RF03211; mir-666

Literature search
8 open access papers mention mmu-mir-666
(10 sentences)

Sequence

21822 reads, 116.0 reads per million, 112 experiments
cugauucugccugcguggAGCGGGCACAGCUGUGAGAGCCcccuagguacagcggGGCUGCAGCGUGAUCGCCUGCUcacgcacaggaagugacgacag
......((.((((.(((((((((((.(((((((...((((((((......)).))))))))))).))...)))))))).))).)))).)).........

Structure
---cugauu  g    c   -        --A  -     GAG      -  ag 
         cu ccug gug gAGCGGGC   CA GCUGU   AGCCcc cu  g
         || |||| ||| ||||||||   || |||||   |||||| ||   
         ga ggac cgc cUCGUCCG   GU CGACG   UCGGgg ga  u
gacagcagu  a    a   a        CUA  G     ---      c  ca 


Annotation confidence High
Do you think this miRNA is real?

Genome context
12: 109683519-109683617 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from mmu-mir-666
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-666-5p

Accession MIMAT0003737
Description Mus musculus mmu-miR-666-5p mature miRNA
Sequence 19 - AGCGGGCACAGCUGUGAGAGCC - 40
Evidence experimental
MPSS [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-666-3p

Accession MIMAT0004823
Description Mus musculus mmu-miR-666-3p mature miRNA
Sequence 56 - GGCUGCAGCGUGAUCGCCUGCU - 77
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298