Stem-loop mmu-mir-673

Accession

MI0004601

Symbol

MGI: Mir673

Description

Mus musculus mmu-mir-673 precursor miRNA mir-673

Gene
family

RF00922; mir-673

Literature search

9 open access papers mention mmu-mir-673
(10 sentences)

Sequence

26073 reads, 203 reads per million, 66 experiments

uggagccugaggggCUCACAGCUCUGGUCCUUGGAGcuccagagaaaauguugcUCCGGGGCUGAGUUCUGUGCACCccccuugcccucca
(((((..(((((((..(((((..((.(.(((((((((..((.......))..))))))))).).))..)))))....)))))))..)))))

Structure

     cc       --CU     CU  G U         uc  ga 
uggag  ugagggg    CACAG  CU G CCUUGGAGc  ca  g
|||||  |||||||    |||||  || | |||||||||  ||  a
accuc  guucccc    GUGUC  GA U GGGGCCUcg  gu  a
     cc       CCAC     UU  G C         uu  aa 

Annotation confidence High

Genome context

chr12: 109571990-109572080 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from mmu-mir-673

Mature mmu-miR-673-5p

• Accession: MIMAT0003739
• Description: Mus musculus mmu-miR-673-5p mature miRNA
• Sequence: 15 - CUCACAGCUCUGGUCCUUGGAG - 36
• Evidence: experimental ; MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6]

Mature mmu-miR-673-3p

• Accession: MIMAT0004824
• Description: Mus musculus mmu-miR-673-3p mature miRNA
• Sequence: 55 - UCCGGGGCUGAGUUCUGUGCACC - 77
• Evidence: experimental ; cloned [4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


5. PubMed ID: 16973894
   Mouse microRNA profiles determined with a new and sensitive cloning method
   "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
   "Nucleic Acids Res (2006) 34:e115


6. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298