miRBase entry: mmu-mir-674

Stem-loop mmu-mir-674


Accession
MI0004611
Symbol
MGI: Mir674
Description
Mus musculus mmu-mir-674 precursor miRNA mir-674
Gene
family?
RF00914; mir-674

Literature search
22 open access papers mention mmu-mir-674
(87 sentences)

Sequence

65192 reads, 238.0 reads per million, 160 experiments
ggccuagucaucacccugagccuuGCACUGAGAUGGGAGUGGUGUAaggcucagguaugCACAGCUCCCAUCUCAGAACAAggcucgggugugcucagcu
(((..((.((.(((((.((((((((..(((((((((((((.(((((..((....)).))))).)))))))))))))..)))))))))))))))))..)))

Structure
   cu  u  u     u        CA             G     ag  u 
ggc  ag ca caccc gagccuuG  CUGAGAUGGGAGU GUGUA  gc c
|||  || || ||||| ||||||||  ||||||||||||| |||||  ||  
ucg  uc gu guggg cucggAAC  GACUCUACCCUCG CACgu  ug a
   ac  -  -     -        AA             A     -a  g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Landgraf et al. show that the 5' miRNA product is the predominant one [4].

Genome context
2: 117015608-117015707 [+]

Database links

Mature mmu-miR-674-5p

Accession MIMAT0003740
Description Mus musculus mmu-miR-674-5p mature miRNA
Sequence 25 - GCACUGAGAUGGGAGUGGUGUA - 46
Evidence experimental
MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-674-3p

Accession MIMAT0003741
Description Mus musculus mmu-miR-674-3p mature miRNA
Sequence 60 - CACAGCUCCCAUCUCAGAACAA - 81
Evidence experimental
MPSS [1], cloned [2,4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115

  6. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298