miRBase entry: mmu-mir-497a

Stem-loop mmu-mir-497a


Accession
MI0004636
Description
Mus musculus mmu-mir-497a precursor miRNA mir-497
Gene
family?
RF00793; mir-497

Literature search
45 open access papers mention mmu-mir-497a
(612 sentences)

Sequence

64121 reads, 867 reads per million, 106 experiments
ccugcccccgcccCAGCAGCACACUGUGGUUUGUAcggcacuguggccacgucCAAACCACACUGUGGUGUUAGagcgagggua
..(((((.(((.(.((((.((((.(((((((((.(((((......)))..)).))))))))).)))).)))).).))).)))))

Structure
cc     c   c C    G    C         U  --   ac 
  ugccc cgc c AGCA CACA UGUGGUUUG Ac  ggc  u
  ||||| ||| | |||| |||| ||||||||| ||  |||   
  auggg gcg G UUGU GUGU ACACCAAAC ug  ccg  g
--     a   a A    G    C         c  ca   gu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 70234717-70234800 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-497a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-497a-5p

Accession MIMAT0003453
Description Mus musculus mmu-miR-497a-5p mature miRNA
Sequence 14 - CAGCAGCACACUGUGGUUUGUA - 35
Evidence experimental
MPSS [1], cloned [2], Illumina [3,5]
Database links
Predicted targets

Mature mmu-miR-497a-3p

Accession MIMAT0017247
Description Mus musculus mmu-miR-497a-3p mature miRNA
Sequence 54 - CAAACCACACUGUGGUGUUAG - 74
Evidence experimental
454 [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771