miRBase entry: mmu-mir-500

Stem-loop mmu-mir-500


Accession
MI0004702
Symbol
MGI: Mir500
Description
Mus musculus mmu-mir-500 precursor miRNA mir-500
Gene
family?
RF01903; mir-500

Literature search
28 open access papers mention mmu-mir-500
(54 sentences)

Sequence

25942 reads, 131.0 reads per million, 153 experiments
cuccucugcucccccucucuAAUCCUUGCUAUCUGGGUGCUUAGUgcuaucucaaugcAAUGCACCUGGGCAAGGGUUCAgagaaggugagc
.......((((.((.((((((((((((((...((((((((....(((.........)))..))))))))))))))))).))))).)).))))

Structure
cuccucu    c  c     -         UAU        UUAG   uau 
       gcuc cc ucucu AAUCCUUGC   CUGGGUGC    Ugc   c
       |||| || ||||| |||||||||   ||||||||    |||   u
       cgag gg agagA UUGGGAACG   GGUCCACG    Acg   c
-------    u  a     C         ---        --UA   uaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse miR-500 was identified independently by two groups. Wheeler et al cloned a mature product with the same length as the human ortholog (MIR:MI0003184) [1]. Mineno et al report a shorter mature product with 1 additional base at the 5' end and 3 fewer at the 3' end (AAUGCACCUGGGCAAGGGUU), referred to as miR-500b in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
X: 7103922-7104013 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-500
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-500-5p

Accession MIMAT0017258
Description Mus musculus mmu-miR-500-5p mature miRNA
Sequence 21 - AAUCCUUGCUAUCUGGGUGCUUAGU - 45
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-500-3p

Accession MIMAT0003507
Description Mus musculus mmu-miR-500-3p mature miRNA
Sequence 59 - AAUGCACCUGGGCAAGGGUUCA - 80
Evidence experimental
cloned [1,3], insitu [1], Northern [1], MPSS [2], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  6. PubMed ID: 16566924
    Identification of new central nervous system specific mouse microRNAs
    "Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T"
    "FEBS Lett (2006) 580:2195-2200