Bta-mir-107 is a microRNA associated with essential cellular processes in lactation and milk synthesis [PMC6164576]. Its expression levels were observed to be higher in late lactation compared to peak lactation, although this finding was inconsistent with Solexa sequencing results, which could be attributed to qRT-PCR deviations [PMC3498112]. Despite this inconsistency, bta-mir-107 was noted for its high expression levels [PMC9407703]. In terms of cellular stability, bta-mir-107 is recommended as one of the three most stable microRNAs for geometric mean calculations [PMC9783024]. Additionally, bta-mir-107 is implicated in a putative functional regulation network, showing a positive correlation with bta-miR-24-3p, but there is no direct evidence of a negative correlation with bta-chr7-64527_mt in the provided reference [PMC7106649]. Instead, bta-miR-24-3p may regulate bta-chr7-64527_mt, which may in turn regulate bta-mir-107, suggesting an intricate regulatory relationship between these molecules.
c c --c u u c u a ucu ugcuuu agcu cu uacaguguugc uug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaa UCGG GA AUGUUACGACG Aac uug g - c CUA - C - - a
| Accession | MIMAT0003785 |
| Description | Bos taurus bta-miR-107 mature miRNA |
| Sequence | 50 - AGCAGCAUUGUACAGGGCUAUC - 71 |
| Evidence |
experimental
cloned [1] |
|