miRBase entry: bta-mir-107

Stem-loop bta-mir-107


Accession
MI0005006
Description
Bos taurus bta-mir-107 precursor miRNA mir-103
Gene
family?
RF00129; mir-103

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Bta-mir-107 is a microRNA associated with essential cellular processes in lactation and milk synthesis [PMC6164576]. Its expression levels were observed to be higher in late lactation compared to peak lactation, although this finding was inconsistent with Solexa sequencing results, which could be attributed to qRT-PCR deviations [PMC3498112]. Despite this inconsistency, bta-mir-107 was noted for its high expression levels [PMC9407703]. In terms of cellular stability, bta-mir-107 is recommended as one of the three most stable microRNAs for geometric mean calculations [PMC9783024]. Additionally, bta-mir-107 is implicated in a putative functional regulation network, showing a positive correlation with bta-miR-24-3p, but there is no direct evidence of a negative correlation with bta-chr7-64527_mt in the provided reference [PMC7106649]. Instead, bta-miR-24-3p may regulate bta-chr7-64527_mt, which may in turn regulate bta-mir-107, suggesting an intricate regulatory relationship between these molecules.

Literature search
12 open access papers mention bta-mir-107
(23 sentences)

Sequence

114480 reads, 633 reads per million, 77 experiments
cucucugcuuucagcuucuuuacaguguugccuuguggcauggaguucaAGCAGCAUUGUACAGGGCUAUCaaagcacaga
.(((.((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...)))))).)))

Structure
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaa   UCGG GA AUGUUACGACG Aac uug g
-   c      CUA    -  C           -   -   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr26: 11348565-11348645 [-]

Database links

Mature bta-miR-107

Accession MIMAT0003785
Description Bos taurus bta-miR-107 mature miRNA
Sequence 50 - AGCAGCAUUGUACAGGGCUAUC - 71
Evidence experimental
cloned [1]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43