Stem-loop bta-mir-107

Accession

MI0005006

Description

Bos taurus bta-mir-107 precursor miRNA mir-103

Gene
family

RF00129; mir-103

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Bta-mir-107 is a member of the brown module and is involved in cellular processes essential for lactation and milk synthesis [PMC6164576]. The human homologue of bta-mir-107, bta-miR-26b, has been shown to play a protective role in breast cancer by promoting apoptosis through targeting SLC7A11 [PMC6164576]. In a study comparing peak and late lactation, several miRNAs were found to be differentially expressed, including bta-miR-15b, bta-mir-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b [PMC3498112]. The expression levels of these miRNAs were higher in late lactation compared to peak lactation tissue [PMC3498112]. However, the expression pattern of bta-mir-107 did not align with the Solexa sequencing results due to potential deviation in qRT-PCR [PMC3498112]. Despite this discrepancy, the high expression of miR-107 (bta-mir-107) led researchers to focus on its role [PMC9407703]. In terms of cellular fraction analysis for miRNA stability determination, GeNorm recommended using the geometric mean of three stable miRNAs: bta-miR103, bta-mir107, and 28 [PMC9783024]. Additionally, putative functional regulation networks were identified based on correlation patterns between different miRNAs [PMC7106649]. For example, there was a positive correlation between bta-miR24–3p and bta-mir–107 [PMC7106649].

Literature search

12 open access papers mention bta-mir-107
(23 sentences)

Sequence

114480 reads, 756 reads per million, 77 experiments

cucucugcuuucagcuucuuuacaguguugccuuguggcauggaguucaAGCAGCAUUGUACAGGGCUAUCaaagcacaga
.(((.((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...)))))).)))

Structure

c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaa   UCGG GA AUGUUACGACG Aac uug g
-   c      CUA    -  C           -   -   a 

Annotation confidence High

Genome context

chr26: 11348565-11348645 [-]

Mature bta-miR-107

• Accession: MIMAT0003785
• Description: Bos taurus bta-miR-107 mature miRNA
• Sequence: 50 - AGCAGCAUUGUACAGGGCUAUC - 71
• Evidence: experimental ; cloned [1]

References

1. PubMed ID: 17105755
   Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
   "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
   "Physiol Genomics (2007) 29:35-43