miRBase entry: bta-mir-193a

Stem-loop bta-mir-193a


Accession
MI0005014
Description
Bos taurus bta-mir-193a precursor miRNA

Literature search
12 open access papers mention bta-mir-193a
(49 sentences)

Sequence

14274 reads, 143 reads per million, 71 experiments
ugggagcugagagcUGGGUCUUUGCGGGCGAGAUGAaggugucgguucAACUGGCCUACAAAGUCCCAGUccucggccccc
.(((.((((((.((((((.(((((.((((.((.((((........)))).)).)))).))))).)))))).))))))))).

Structure
u   a      a      U     C    G  A    ggu 
 ggg gcugag gcUGGG CUUUG GGGC AG UGAa   g
 ||| |||||| |||||| ||||| |||| || ||||    
 ccc cggcuc UGACCC GAAAC UCCG UC Acuu   u
c   -      c      U     A    G  A    ggc 


Annotation confidence High
Do you think this miRNA is real?
Comments
High-throughput sequencing suggests that the dominant miRNA arises from the 5' arm of this precursor [2], in contrast to earlier cloning studies.

Genome context
chr19: 18931346-18931426 [-]

Database links

Mature bta-miR-193a-5p

Accession MIMAT0003794
Description Bos taurus bta-miR-193a-5p mature miRNA
Sequence 15 - UGGGUCUUUGCGGGCGAGAUGA - 36
Evidence experimental
cloned [1], Illumina [2]

Mature bta-miR-193a-3p

Accession MIMAT0003795
Description Bos taurus bta-miR-193a-3p mature miRNA
Sequence 49 - AACUGGCCUACAAAGUCCCAGU - 70
Evidence experimental
cloned [1], Illumina [2]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349