miRBase entry: bta-mir-34c

Stem-loop bta-mir-34c


Accession
MI0005068
Description
Bos taurus bta-mir-34c precursor miRNA mir-34
Gene
family?
RF00456; mir-34

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-34c is a microRNA that has been studied in various contexts [PMC7214931]. It has been found to be differentially expressed between fresh and frozen sperm [PMC7214931]. In one study, bta-mir-34c was selected for RT-qPCR validation to investigate the credibility of high-throughput sequencing [PMC6876490]. It was predicted that bta-mir-34c could bind to and regulate the expression of DDIT4 [PMC6876490]. Additionally, bta-mir-34c was confirmed to be downregulated in different studies [PMC6876490][PMC6949159][PMC9581129'>PMC6876490][PMC6949159][PMC9581129[PMC6949159][PMC9581129]. It was found to share targets with other miRNAs, such as ACAD10, PYCR1, and CLDN2 [PMC6876490]. DDIT4 was identified as a target shared by bta-mir-34c and another miRNA, bta-miR-449b [PMC6876490]. Bta-mir-34c has been implicated in cell transformation induced by BPV E5 and is involved in cancer progression and angiogenesis through the regulation of PYCR1 and DDIT4 [PMC6876490]. Technical validation of miRNA-seq data has been performed using RT-qPCR on bta-miR-100 and bta-mir-34c, which are highly expressed in bull spermatozoa [PMC9581129][PMC6731312[PMC6731312]. Bta-mir-34c is significantly downregulated in cattle-yak testis and plays a role in promoting the transition of spermatogonia from mitosis to meiosis [PMC9785434][PMC7312616[PMC7312616].

Literature search
14 open access papers mention bta-mir-34c
(80 sentences)

Sequence

373 reads, 18 reads per million, 50 experiments
agucuaguuacuAGGCAGUGUAGUUAGCUGAUUGcuaauaauaccaaucacuaaccacacggccagguaaaaagauu
.((((..(((((.(((.((((.(((((.((((((.((....)).))))))))))).)))).))).)))))..)))).

Structure
a    ag     A   A    A     C      c  a 
 gucu  uuacu GGC GUGU GUUAG UGAUUG ua u
 ||||  ||||| ||| |||| ||||| |||||| ||  
 uaga  aaugg ccg caca caauc acuaac au a
u    aa     a   g    c     -      c  a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature miR-34c sequence identified by Sonstegard et al [1] has an A base at position 11 of the mature miRNA, which conflicts with the draft genome sequence that has G as shown here.

Genome context
chr15: 22282382-22282458 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-34c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-34c

Accession MIMAT0003854
Description Bos taurus bta-miR-34c mature miRNA
Sequence 13 - AGGCAGUGUAGUUAGCUGAUUG - 34
Evidence experimental
cloned [1], Array [2], qRT-PCR [2]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19170227
    Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach
    "Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M"
    "Mol Reprod Dev (2009) 76:665-677