Ame-mir-34 is a microRNA that was analyzed using the 2−ΔΔCt method to determine its relative expression level [PMC9863880]. In the 4-day-old larval gut, the upregulation of ame-mir-34 was observed, but there was no significant difference in its expression level between the A. apis + mimic-miR-34 group and A. apis + mimic-NC group [PMC9863880]. This suggests that there may be other unknown factors influencing the regulation of abct expression at this stage [PMC9863880].
uuu g uUG U U - ua uuuugcgauug caug GCAGUGUUG UAGC GGUUGugug gc c ||||||||||| |||| ||||||||| |||| ||||||||| || gggaugcuagc guau cgucacggc aucg ccagcauau ug a --u a uaa u - a uu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0004430 |
Description | Apis mellifera ame-miR-34-5p mature miRNA |
Sequence | 21 - UGGCAGUGUUGUUAGCUGGUUG - 42 |
Evidence |
experimental
Illumina [2] |
|