WARNING: This summary was generated by AI. Ame-mir-34 is a microRNA whose expression levels in the larval gut of 4-day-old larvae were quantified using the 2−ΔΔCt method [PMC9863880]. Although an upregulation of ame-mir-34 was observed in this developmental stage, comparative analysis revealed no significant difference when larvae were co-treated with A. apis and a mimic of miR-34 versus a control mimic [PMC9863880]. This suggests that ame-mir-34's expression might be influenced by additional factors that were not identified in this study [PMC9863880].
uuu g uUG U U - ua uuuugcgauug caug GCAGUGUUG UAGC GGUUGugug gc c ||||||||||| |||| ||||||||| |||| ||||||||| || gggaugcuagc guau cgucacggc aucg ccagcauau ug a --u a uaa u - a uu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0004430 |
| Description | Apis mellifera ame-miR-34-5p mature miRNA |
| Sequence | 21 - UGGCAGUGUUGUUAGCUGGUUG - 42 |
| Evidence |
experimental
Illumina [2] |
|