Stem-loop osa-MIR444e

Accession

MI0006977

Description

Oryza sativa osa-MIR444e precursor miRNA

Literature search

23 open access papers mention osa-MIR444e
(67 sentences)

Sequence

1247 reads, 872 reads per million, 2 experiments

gguuuuguaaccaggggcaauaagcuagaggcaccaacugcauaacuugcgagaaacuuguuggaugaugaucuugccaaugauuuugccgcaaguuaUGCAGUUGCUGCCUCAAGCUUacugccuuuguuugcuaaacc
(((((.((((.((((((((.((((((.((((((.(((((((((((((((((..(((.(((((((............))))))).)))..))))))))))))))))).)))))).)))))).)))))))).)))).)))))

Structure

     u    c        a      a      c                 ag   c       augau 
gguuu guaa caggggca uaagcu gaggca caacugcauaacuugcg  aaa uuguugg     g
||||| |||| |||||||| |||||| |||||| |||||||||||||||||  ||| |||||||      
ccaaa cguu guuuccgu aUUCGA CUCCGU GUUGACGUauugaacgc  uuu aguaacc     a
     u    u        c      A      C                 cg   u       guucu 

Annotation confidence Not enough data

Genome context

Unknown

Mature osa-miR444e

• Accession: MIMAT0005975
• Description: Oryza sativa osa-miR444e mature miRNA
• Sequence: 99 - UGCAGUUGCUGCCUCAAGCUU - 119
• Evidence: experimental ; MPSS [1], Northern [1], cloned [2]

References

1. PubMed ID: 18312648
   Identification of novel and candidate miRNAs in rice by high throughput sequencing
   Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK
   BMC Plant Biol (2008) 8:25


2. PubMed ID: 18353984
   Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)
   "Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ"
   "Proc Natl Acad Sci U S A (2008) 105:4951-4956