Stem-loop osa-MIR1428d

Accession

MI0008238

Description

Oryza sativa osa-MIR1428d precursor miRNA

Literature search

5 open access papers mention osa-MIR1428d
(24 sentences)

Sequence

4 reads, 2 reads per million, 2 experiments

gguuaguguacuuugcgaauucacaggcccuauauugugguaugaacugaguacgcgaugauuuauggugcauauugggggcuuaccaUAAGAUAAUGCCAUGAAUUCGcaaaguguucaaacc
((((.(..(((((((((((((((..(((..(((.((((((((.(..((.(((((((.(((...))).)))..)))).))..).)))))))).)))..))).)))))))))))))))..).))))

Structure

    a ug               ca   cc   a        u aa  g    --   g   a 
gguu g  uacuuugcgaauuca  ggc  uau uuguggua g  cu agua  cgc aug  
|||| |  |||||||||||||||  |||  ||| |||||||| |  || ||||  ||| ||| u
ccaa c  gugaaacGCUUAAGU  CCG  AUA AAUaccau c  gg uuau  gug uau  
    a uu               -A   UA   G        u gg  g    ac   g   u 

Annotation confidence Not enough data

Genome context

Chr3: 23077268-23077391 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from osa-MIR1428d

Mature osa-miR1428d

• Accession: MIMAT0007783
• Description: Oryza sativa osa-miR1428d mature miRNA
• Sequence: 89 - UAAGAUAAUGCCAUGAAUUCG - 109
• Evidence: experimental ; 454 [1]

References

1. PubMed ID: 18687877
   A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains
   "Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C"
   "Genome Res (2008) 18:1456-1465