miRBase entry: osa-MIR1428e

Stem-loop osa-MIR1428e


Accession
MI0008239
Description
Oryza sativa osa-MIR1428e precursor miRNA

Literature search
7 open access papers mention osa-MIR1428e
(50 sentences)

Sequence

5 reads, 3 reads per million, 2 experiments
gcgcuuggcgAAUUCACAGGCCCUAUCUUGUGguaugaacuggguacgcgaugauuugcacugcguauugggggcuuaccaUAAGAUAAUGCCAUGAAUUUGucaagcgu
((((((((((((((((..(((..((((((((((((.(..((.((((((((.((.....)).)))))))).))..).))))))))))))..))).))))))))))))))))

Structure
                CA   CC            u aa  g        a  a 
gcgcuuggcgAAUUCA  GGC  UAUCUUGUGgua g  cu gguacgcg ug u
||||||||||||||||  |||  |||||||||||| |  || |||||||| || u
ugcgaacuGUUUAAGU  CCG  AUAGAAUaccau c  gg uuaugcgu ac u
                -A   UA            u gg  g        c  g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr3: 23076870-23076979 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from osa-MIR1428e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature osa-miR1428e-5p

Accession MIMAT0007784
Description Oryza sativa osa-miR1428e-5p mature miRNA
Sequence 11 - AAUUCACAGGCCCUAUCUUGUG - 32
Evidence experimental
454 [1], Illumina [3]

Mature osa-miR1428e-3p

Accession MIMAT0007785
Description Oryza sativa osa-miR1428e-3p mature miRNA
Sequence 82 - UAAGAUAAUGCCAUGAAUUUG - 102
Evidence experimental
454 [1], cloned [2]
Database links

References

  1. PubMed ID: 19055717
    Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice
    Lacombe S, Nagasaki H, Santi C, Duval D, Piégu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M
    BMC Plant Biol (2008) 8:123

  2. PubMed ID: 18687877
    A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains
    "Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C"
    "Genome Res (2008) 18:1456-1465

  3. PubMed ID: 19103661
    Characterization and expression profiles of miRNAs in rice seeds
    "Xue LJ, Zhang JJ, Xue HW"
    "Nucleic Acids Res (2009) 37:916-930