miRBase entry: aga-mir-1889

Stem-loop aga-mir-1889


Accession
MI0008309
Description
Anopheles gambiae aga-mir-1889 precursor miRNA

Literature search
3 open access papers mention aga-mir-1889
(10 sentences)

Sequence


uguggcguggaugggcggcaaucucaaauuguaauagugugucaccguuaacggcuggaccauugugcugccaucgugauccaccgagaaaaacACACAUUACAGAUUGGGAUUAccccguccaugcuccg
.(.((((((((((((.(..((((((((.(((((((.((((((.....((..(((.((((.(((.(((....))).))).)))))))..))..))))))))))))).)))))))).))))))))))))).).

Structure
u u            c gc        a       a      caccg  aa   c    c   u   c 
 g ggcguggauggg g  aaucucaa uuguaau gugugu     uu  cgg ugga cau gug u
 | |||||||||||| |  |||||||| ||||||| ||||||     ||  ||| |||| ||| |||  
 c ucguaccugccc c  UUAGGGUU GACAUUA CACAca     aa  gcc accu gug uac g
g c            - -A        A       -      ---aa  ga   -    a   c   c 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
chr2R: 37888789-37888919 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from aga-mir-1889
Name Accession Chromosome Start End Strand Confidence




Database links

Mature aga-miR-1889

Accession MIMAT0007859
Description Anopheles gambiae aga-miR-1889 mature miRNA
Sequence 95 - ACACAUUACAGAUUGGGAUUA - 115
Evidence not_experimental

References

  1. PubMed ID: 18500992
    Cloning, characterization, and expression of microRNAs from the Asian malaria mosquito, Anopheles stephensi
    Mead EA, Tu Z
    BMC Genomics (2008) 9:244